FANDOM


Statue is a special dungeon feature added in ADOM version 1.2.0. These statues, unlike normal statues, found in the Bug Temple or created by Petrification, are not items but are immovable objects that have chance to be generated on a generic dungeon level. Each statue features a unique description, which will be displayed as the PC moves onto its location, and (most) statues have a unique effect which can be triggered by one of the following actions:

  • Kicking the statue
  • Moving onto the statue's tile and waiting a turn..
  • Praying while standing on the statue's tile
  • Using magic (spell or wand) on the statue's tile
  •  ???

Each statue was submitted by one of the ADOM Resurrection campaign participants of Adventurer or higher pledge levels.

Statue mechanicsEdit

AppearanceEdit

If the PC moves on a statue's location, the message You stumble upon a statue. <statue description>. will be displayed; if the PC is literate, this will be followed by the message: An inscription at the bottom reads: "<statue inscription>".

Special messagesEdit

If a statue is located on the current level, the following message will be displayed periodically: "You sense something of historical significance."

This message appears to be working as all other fixed dungeon features' (forges, altars etc.) messages.

List of all known statuesEdit

The following list contains all discovered statues.

Title/Subject Appearance Inscription Effect Trigger Effect Activation Message Notes
Quasit It resembles a small little ugly quasit, hewn from gabbro basalt. In its hands the statue holds some sort of shovel. "a good shovel is a key to tomb robbery" Kick Learn Mystic Shovel spell. You learn the Mystic Shovel spell.

You learn the Divine Digger spell. (for divine casters)

Unfinished The statue is unfinished, it's as though the sculptor ran out of time. No inscription Wait on Reverses (some) unnatural aging You Feel (sic) younger Editor noticed all four years of unnatural aging removed from a PC. Also, having age status changed from 'grown-up' to 'young' did not affect stats
Eleanoreus Regina It appears to be of a fair skinned Queen, with hair of rose gold and eyes of uncut blue-gray sapphires. "Eleanoreus Regina Reigns" Wait on Stuns the PC You feel sunburned!
Drakeling Ranger A drakeling ranger in a readied combat stance wielding a pair of gladii. "Vae Victis" Kick Temporary Buffs speed by 25/26 and strength by 9. The Statue crumbles to dust! You quicken. (You slow down somewhat. You feel your strength waning.) "Vae Victis" is Latin for "Woe to the vanquished"
Quickling It resembles a quickling. "Trrrr digi dagi, muf muf!" Kick Permanently increases speed by 5. You feel faster.
Rune Die It is a large cube of gray stone, with one large rune carved into each face of the cube. "Provoke not The Four, their gifts are Destiny and Doom" Kick Teleports PC away (other effects also possible?) "Suddenly you stand somewhere else."
Nosaj, Troll Healer It is covered in cracks, and thick dirt but appears to be Nosaj the ancient Troll Healer. "Be aR T E pOw r O C AoS" Kick Summons several Greater chaos servants around you, and drops a cursed potion of cure corruption. "Suddenly an item is lying on the ground." Note that Nosaj is Jason backwards
Ancardian Boy It resembles a young Ancardian boy accompanied by what appears to be a stuffed tiger doll, riding together in a small red cart. The statue seems to be constructed of a multitude of nondescript items. "THERE'S TREASURE EVERYWHERE!" Kick Transforms all items lying diagonally-adjacent to the statue into gold pieces "Suddenly all items transform into gold." The statue appears to be a reference to the Calvin and Hobbes [1] comic series
Mother It resembles your mother?! "Be safe, pumpkin!" Kick Curses "A voice in your head says "Is that really how you treat your mother?" "
Mylar Starstruck A bare-chested human with a full beard stands hunched over an empty anvil, his brow furrowed in concentration. His right hand carries a rune-carved (sic) hammer, raised as if to strike. "Mylar Starstruck" Wait on Trains smithing for not very skilled (<50 ?), alternatively repairs equipped melee weapon. Breaks it if not skilled at all. "Your eternium battle axe is suddenly repaired" or "You gain new insights into the art of smithing." or "Your club breaks." or "Nothing happens." (artifact melee weapon equipped)
Humanoid It resembles a naked humanoid with a huge head, wearing a necklace. You try to remove the necklace, but the head is too big. "Z" Zap a wand Generates an amulet. An amulet of balance, amulet of health, amulet of free action and amulet of protection have been received. The amulet generated may depend on DL? "Suddenly an item is lying on the ground"
Black Cat Lights play on the gemstones, the ivory horn glitters in multitude of colors cast by the reflections. The statue resembles a black cat forged of pure obsidian, riding a rainbow unicorn! "Nya Nya Nya Ruslan" Wait on Grants luck; may grant fate smiles if character already has luck. "You feel as if the light of Fate shines upon you favorably!" This statue appears to be a reference to the Nyan Cat [2] internet meme.

The message appears to be the same regardless of what intrinsic is granted.

Max Otto von Stierlitz It resembles a tall human wearing a heavy coat with a peaked cap on its head bearing eagle- and skull-shaped insignia unknown to you. You can almost feel his cold stare probing deep into you. "Max Otto von Stierlitz" Wait on Grants temporary cold immunity; seems to make PC "sneeze exactly once!" later? "You feel cozy!" This statue is a reference to Seventeen Moments of Spring [3], a Soviet series
Human Girl It resembles a young human girl of seven or eight, carved from obsidian. "I forgive nothing." Kick Possibly decreases piety No message Possibly a reference to Nikki from Kill Bill Volume 1 [4]
Neji A marble Dark Elven archer stands here. He looks very powerful and very corrupted. You sense a faint soul here. "Neji. — Defeated all his foes except for the chaos inside of him." Pray Asked to help a voice from elsewhere, saying "yes" will cause three corruptions or removes all(?) corruption. At least 12 corruptions were removed. From the other worlds, you hear a whisper asking you "Hero - I am in agony here, will you help me?" (y/n) The marble eyes open to reveal glowing balls of envy and pain. You feel a soul rushing into your body battling for control! Resisting you tear yourself away from the statue. You feel corrupted/You feel cleansed. Level 10 human chaos knight gained 3 corruptions.

Level 7 myst elf necromancer, all 5 corruptions removed.

Level 20 neutral high elven elementalist, all 3 corruptions removed.

Level 45 gray elven elementalist, crowned N=, all 12 corruptions removed.

Adar, Guardian Battlemage It depicts a standing warlock, holding a sharp, glittering sword with a hilt shaped like a miniature dragon. "Adar, Guardian Battlemage." Kick Generates a murderous short sword of slaughtering
Chaos It looks like nothing you've ever seen. The form twists and shifts constantly, shimmering with dizzying energy. "dEDiCaTeD tO tHe eSsEnCe Of ChAoS. mAy yOu AlWaYs ChAnGe!"
Obsidian Block It looks like a large, black stone block. It is probably made of obsidian. No inscription Wait on Trains random skill or granting a new one. "You feel uplifted!" This is a reference to the film 2001: A Space Odyssey [5] - the obsidian block is the monolith, uplifting an inferior species.

Level 1 DfDu with Le:8 got Pick Pockets at 33 (2d4) without having visited the Thieves Guild.

Humanoid The vaguely humanoid form is completely overgrown with various plant life and crawling with insects. No inscription Kick May either generate several edible plants, or summons two insect monsters. "Suddenly some items are lying on the ground." /

"You notice some enemies appearing."

Observed plants include a seed and apple, and a seed and 2 alrunia antidotes; summoned monsters noticed have included giant bee warriors, giant centipedes, giant ant workers and claw bugs.
Kallisti It's of a dark-haired woman wearing a toga and holding out a golden apple "Kallisti" Wait on Seems to be equivalent to drinking from a Pool. "You suddenly picture yourself biting into a tasty apple! It fills your mouth with a refreshing liquid!" This statue appears to be a reference to the Apple of Discord [6]; the woman thus is Eris, the goddess of chaos and strife
Bookshelf It resembles a bookshelf, crafted from stone. Each book inside is crafted from a different type of rock. You don't understand the titles. "Do you know where your towel is?" Wait on Generates a blanket This is a reference to the Hitchhikers Guide to the Galaxy [7]
Maen The life-sized female human monk in a fighting position is carved from a single block of ivory, her arms spread in a defensive figure. ... "Maen, the Kata Training Master of Dela" Kick (repeatable) Unknown
Human man It resembles a slightly eccentric man with long blonde flowing hair, arm held upward with a curious object in his hand. "Gardening is the game of life!" Kick Causes herbs to appear in a 'Glider' shape (might be just one bush if there is not enough room near the statue) The statue crumbles to dust! Suddenly some herbs appear! Refers to the fact that herbs are growing by the rules of Conway's Game of Life [8]
Penguin It seems to look like a penguin... in a strange way. "CP-Violation will be prosecuted by CERN." This is likely a reference to penguin diagrams [9], a class of diagrams in quantum field theory.
Merchant It looks like an east merchant, made from gold. "ALL YOUR MONEY ARE BELONG TO ME." Wait on (see notes) 2% (rounded up) of the PC's gold goes disappears. You feel slightly less encumbered. This statue appears to be a reference to the AYBABTU [10] video game meme. The statue appears to activate only once, but it will not activate if the PC has no gold pieces.
Human man It is a man with a benign smile and hair like a halo. "Long live the Vampire Slayer!" Pray Restores all PP. You feel full of power.
Magician It resembles an old magician. "Hockaz Pockhus 187-299" Cast spell? Random (undead?) monster appears. Upon casting a spell, a wraith and a ghul have been generated.
Wizard It resembles an aged wizard in a dynamic pose, brandishing an ornate wand. "In honor of the grand wandmaker ... (the rest of the inscription is worn away)" Nothing happened when the PC zapped an unidentified wand.
Dragon It resembles a dragon, but on each scale, an emblazoned rune shines. "Callest the Thunder, and He shall Reapeth the Whirlwind." Kick Unknown Note that this is grammatically incorrect; it should read either shall reap or reapeth. Also, callest is the indicative mood where imperative seems to be required
Pajazzo and Ulysses It depicts two enormous dogs, pitch black and wolf-like appearance, standing guard over a fallen soldier. Their eyes seem to watch your every move... "Here stands Pajazzo and Ulysses, never resting, ever watching." Kick Increases Toughness by 1 point Note that potential doesn't increase.

Increase Pe +1 for GEWz To 10. Nothing happens for HEAr To 34+5.

Elf It is of a kneeling Elven man, carved from simple granite. "The Scions walk with you!" Wait on Same effect as a (blessed) potion of boost willpower. "You feel determined!"
Richard It bears a striking resemblance to Richard, the warp duck of lore. "Qua... ...ck." Zap a wand Teleports PC You teleport.
Clown It looks like an evil clown juggling human skulls. "Gravity sucks" Wait on Turns all monsters on level hostile, including companions "The clown laughs at you, the laughter echoes through the dungeon."
Crumbled Crumbling and fallen, only the feet remain. You notice that each foot has only four toes. "Aut viam inveniam aut faciam" Pray Increase Willpower by one "You suddenly know that you will either find a way to achieve your goals or that you will make one." The Latin phrase means "I shall either find a way or make one" and is attributed to Hannibal [11]
Human woman It is carved to depict a small woman, on her knees with her face drawn in a rictus of terror. "Fear is the only weakness" Kick Summons random(?) undead(?) hostile monster Possible monsters: Wraith
Sphere It's a perfect sphere the size of a man's head, glowing with a faint green light. No inscription Unknown Uncurses equiped items Kicked as a lvl7 L Dwarf Priest, Unicorn Sign, got "A huge fireball explodes!", took about 25hp of damage and "The statue crumbles to dust". No detectable event other than the explosion and disappearance of the statue.

---

Kicked as lvl10 Drakish male Monk, Candle Sign, got no effect.

Aldrin the Always Prepared It resembles a huge heap of old armor, rusted weapons, wands and small bottles. For a moment, you think you see something moving underneath... "Aldrin the Always Prepared" Kick Drops a girdle of carrying "An old belt falls from the statue. It seems to still be useable..."
Jackal It is a sandstone figure of a small dog. Its ears taper to points, and carved muscles bulge underneath its skin. "To the unknown jackal." Pray Causes a tame jackal to appear. Suddenly a jackal appears.
Wizard, Mad It looks like a mad wizard ripping pages out of a spellbook. "Knowledge is a finite resource: the more you learn, the more you forget" Kick PC un-learns a skill at random, then the PC learns a new random skill or improves an existing skill. (First editor said at skill level 1d100, second editor always got full 100). Small chance of only losing a skill without any gain, and similarly a small chance of only a gain without losing a skill.
Human Man It appears to be a large crowned bearded man surrounded by carved squirrel companions. "You shall nut pass!" Kick Randomly spawns additional (hostile?) monsters on the level.

Crashes the game in pre23, fixed in current versions.

"A booming voice bellows: "Ye have incurred wrath of the Squirrel King!"

The stone squirrel companions spring to life and surround you!"

Pun on Tolkien's Gandalf [12]
Avatar of Balance It is of an Avatar of Balance, a wide cloak billowing around him. The avatar's left arm is hidden by the cloak, but his right arm extends outward and holds a sword as tall as the avatar, the tip just touching the ground. Hanging from the cross-guard is an ornate pair of scales, perfectly balanced on fine chains. "To the ancient judges; in whose dominion Balance reigned supreme." Pray Unknown; prayer is also heard by PC's deity "Your prayers are heard." Editor was playing as a neutral PC
Eroded It seems quite brittle and eroded. You can't decipher what it once may have resembled. No inscription Wait on PC becomes blinded by dust eroding from the statue. The effect is similar to the glob of mud rooms, since it can only be cured by using the wipe face command. When activated: "You are blinded by the dust eroding from the statue."

When remedied: "You clean your face from all the dust."

Great Lord It is carved from a single, solid piece of granite. It seems to represent a once great lord of some considerable girth wrapped in grand robes. He is resting upon a throne before which stands a pedestal holding a great tome with archaic runes. "You gain some, you lose some. You can't have it all." Unknown Activation methods attempted: kick, pray, read spellbook, read scroll, zap wand, cast spell - no step-on message
Humanoid It resembles a humanoid standing square and emotionless. It appears to be missing a chunk of stone on his head. "75% Off" Kick Statue breaks and summons Doop, a tame stone golem. "The statue hums and vibrates for a moment, and then appears to come to life. It slowly turns toward you and mutters: "Zoop bing bada doop." "
Mieaevar It resembles a tall, winged figure clad in a breastplate and gripping a broadsword. You feel faint waves of blessed power emanating from the sword. "Mieaevar" Wait on Restores some HP and PP. (For lawful only ?) "You feel righteous... and right!"
Hippo Headed Male It seems to be a male figure with the head of a hippopotamus, made of granite. "GueuetiteueuG" Wait on (repeatable) Confuses the PC if not already confused, removes confusion if already confused
Man, Old It depicts an old man wearing sideburns. The man is holding a scroll with a 17-pointed star inscribed on it. No inscription Cast spell Temporary +20 Le This is likely a reference to Carl Friedrich Gauss [13], a German mathematician.
Computer It looks like a very great computer from the beginning of the 1980ties, it is brown and very similar to a bread bin. "Commodore C64, Made In W. Germany" Pray Restores HP; prayer is also heard by deity "You feel healed. Your prayer remains unheard."
Giant Rat It is a wooden statue of a giant rat. "Squeek!" Kick Summons hostile giant rat(s)
Mighty Hero A mighty hero stares down at you from the golden pedestal. You are awed by the strong and yet graceful curves. This is truly a godly figure. Oh wait... you recognize yourself! "Self-esteem is golden, but valor is beyond price" Kick Destroys the statue, reduces HP to 1 and generates 100 gold in the statue's place; deafen the PC for 100 turns; clears cursed and doomed intrinsics; grants +1 Willpower and +1 Appearance "The statue crumbles to dust! Suddenly you hear a thousand bells ringing in your head. You fall onto the ground writhing in pain. And yet you feel good about what you just did. Suddenly an item is lying on the ground."
Octopus Headed Monster It represents a monster of vaguely anthropoid outline, but with an octopus-like head whose face is a mass of feelers, a scaly, rubbery-looking body, prodigious claws on hind and fore feet, and long, narrow wings behind. "Ia! Q'thulu ftaghn!" Wait on Grants Lucky intrinsic to chaotic PC, temporarily confuses others Reference to Cthulhu of the Lovecraft mythos [14]
Sphere It's a sphere. "That's no moon." Wait on Generates a stack of cursed penetrating drakish scurgari of targeting "Suddenly an item is lying on the ground" Level 6 L DwDu received 4. Possibly a reference to Obi-Wan's line from A New Hope.
Man, Barrel-chested On closer inspection it looks like a barrel-chested man. His eyes are flickering and shimmering in thousands of colours. He is smiling at you with seemingly endless joy, careless joy, knowing that his lucky day could be the day of your doom. "Does fate smile upon you?" Wait on Decreases luck (like karmic creatures). Or increases it (depending on Mana (40+) ?) "You feel less lucky"/"You feel more lucky" A PC once lost the Fate Smiles intrinsic by it, while another PC with no positive luck-based intrinsics received the cursed intrinsic from it
Water It is made of some unnatural watery substance which streams without losing its form. The statue seems to be vaguely familiar to you. ... "Who are you?" Kick Increases Willpower by 2 and Charisma by 5; corrupts; destroys statue "You hesitate, and then suddenly kick the statue with full force. The statue shatters. You are annoyed by your own weaknesses, but immediately feel proud and confident again for overcoming them." At least three PCs have been observed to transform into a chaos being after gaining 18/19 corruptions at once (if PC is Chaotic or Neutral?). Other PCs have been observed to pick up one corruption that was not announced by the game after kicking the statue.
Warrior It is a warrior carved in white stone, sword in hand, another sword strapped to his back. You notice a finely crafted wolf's head talisman hanging on his neck. "To G. of R., a true hero and friend of dwarvenkind." Wait on Generates a necklace of the eye Suddenly an item is laying on the ground. This is a reference to Geralt of Rivia, the main protagonist of the Witcher [15] series.
Human It resembles a human, whose appearance seems to be strangely familiar. "Sometimes, you gotta run before you can walk" Wait on Increases Speed by 5 "You speed up."
Dragon, ancient black It resembles an ancient black dragon, hewn from pure black diamond. "nive idvi ciiv" Pray With ~50% chance generates a sword of sharpness Suddenly an item is laying on the ground / You have a feeling of loss The inscription is an anagram of the phrase "veni vidi vici" [16]
Permafrost It is covered with permafrost and is too cold to touch. "I long for eternal frost and black winters."
Dijheans Upon it stands a man, tall with close cropped hair. He wears strange bulky armor only covering the torso, with a rounded helmet. In his hands is a gently curved sword, held in a ready, yet relaxed position. He carries a pack that looks extremely heavy. "Dijheans, he fought in a war that did not remember him or his comrades." Wait on +10 Capacity "You notice your burden lightens slightly."
Man, handsome It depicts the face of a man of about forty-five, with a heavy black moustache and ruggedly handsome features. "Ignorance is strength." Kick +1 Willpower "You suddenly know that you will either find a way to achieve your goals or that you will make one." Appears to be a reference to George Orwell's novel 1984 [17].

Crashes the game in pre23 (win7 64bit)

Woman, despairing Delicately carved from granite and smoothly polished, a young, lithe woman lies prostrate on an ornate settee. She is clothed in thin, revealing attire, with one hand resting wearily against her forehead, and the other reaching languidly outwards. Her posture suggests great personal despair. "...and 'lo that wench, upon this bench, her fate was sealed in stone." Wait on Deafens the PC. "Your ears are assaulted by a high-pitched screeching... then you hear nothing at all." or "Your ears tingle." (if already deaf)
Monkeys It resembles 10 shining monkeys, hewn from pure Diamond. "SSAGAZY!" Wait on Same effect as a blessed scroll of identify "You feel enlightened!"
Farmer It resembles a strong farmer with a dog by his side wielding an ancient trident. "Hard work and a strong back can overcome any obstacle." Kick Generates a trident and two potions of strength Suddenly some items are lying on the ground
Tree It appears to be a stone tree, covered with specks of dried blood. "Ouch!" Kick Causes heavy bleeding
Knight It resembles a fearful knight. Pure darkness radiates from its obsidian eyeballs. "Only the penitent man shall pass." Pray Corrupts (~1 effect) May be a reference to Indiana Jones and the Last Crusade[18]Praying here while being chaos knight did removed 5 corruptions including the starting ones.
Woman, gorgeous It is shaped as the most gorgeous woman you ever saw, with stunning eyes and shimmering hair. You feel a surge to deliver her. No inscription Pray Summons a doppelganger; prayer seems to also be heard by PC's deity "As <PC's deity> relieves the prisoner from its petrified state, she suddenly transforms into a very known person. Your prayers remain unheard." Male or female characters
Fish It shows a leaping fish. No inscription Kick Unknown No message
Bundin the Besotted It appears to be a dwarf, brandishing a battleaxe with one hand, and with the other drinking deeply from a frothing tankard. "Bundin the Besotted - His virtue was solid, and his courage, liquid."
Barbarian The statue is cast in bronze and resembles a Barbarian accompanied by a snarling dog. "Pray that your dog never bites you!" Pray Creates a tame monster
Goblin Berserker It resembles a goblin berserker, hewn from a 100 carat brilliant blue sapphire "Chaos will prevail" Kick Grants intrinsic invisibility to the PC
Giant Frog It looks like a giant frog made of pure emerald. "Berep!" Wait on Grants Lucky intrinsic "You suddenly hear a croaked "Berep". You feel the urge to smile!"
Rocks It is made from shiny round rocks, vaguely resembling a hurtling (sic) figure. No inscription Kick Drops a pile of rocks "Suddenly an item is lying on the ground. The statue crumbles to dust!" Dropped 5 (+2, 1d4) rocks

Dropped 6 (+0, 1d4) rocks in another instance - seems like the rocks are random

Disc It appears to be a standing disc filled with a mix of blue and purple stained glasses in a complicated kaleidoscopic pattern on both sides. It is supported by a grey stone carving that resembles a large cloud. "Winds of Omen"
Hurthling It is a tall statue of a short figure; a hurthling with a determined grin and a full pack. Graffiti scratched into the stone reads "Better a small fire that warms than a great fire that burns" "The Lost Volcano Expedition" Wait on Grants resistance to fire, stunning and confusion "You feel ready for the heat!" Once of the statues in the Bug Temple is dedicated to a hurthling, called Wor Janoth, who was the "Explorer of the Lost Volcano".
Horse headed figure It resembles the head of a horse. It expression is an ambiguous mix of panic and frenzied elation. "Prepare for Final Fulfillment" Kick Permanently increases speed 5 points OR drops a wand (possibilities include door creation, digging, acid, fire, lightning at least) OR does nothing. "You feel faster." OR "Suddenly an item is lying on the ground." OR no message.
Hemisphere It is shaped like a perfect hemisphere, made from some unknown metal. Though its surface is tarnished, you can still see your distorted reflection. No inscription Kick Generates a fireball centered on the statue. "A huge fireball explodes! You are engulfed by the roaring flames! The statue crumbles to dust!" (ADOM release 52). "The statue crumbles to dust! You feel a strong shock wave." (ADOM 1.2.0 Prerelease 23?) Generates an "Illegal ball damage type(3)." error in ADOM 1.2.0 Prerelease 23.
Pan It is covered in moss and has lost some of its original definition to the ages it was sculpted. It resembles a man, with the legs of a beast. He holds something in his hands, a musical instrument or tablet bearing writing in some forgotten script? "The Great God Pan" Direct reference to the god Pan [19] in Greek mythology.
Wizard, Old It resembles an old wizard, hewn from fine, white marble. "DO NOT DISTURB!" Kick Stuns for a few turns, teleports PC and drops alignment. No message N- high elven druid got to C after kicking the statue.
Dragon, dead It depicts an ancient dragon slumped, dead on the floor. A goblin stands atop it, victorious. "For the cursed will be blessed and the earth shall be theirs." Kick Wand of digging appears on the floor; also generates wand of earthquakes for cursed PC and wand of destruction for doomed PC Suddenly an item is lying on the ground.
You The statue looks surprisingly much like you, only smaller. "Ye who wants to know it all should know thyself first." Kick Same effect as potion of insight / Revelation spell; or else same effect as potion of confusion. "You suddenly feel very self-knowledgeable." or "You are confused." Seems to depend on learning (literate/Le:18 works, illiterate/Le:8 doesn't, illiterate/Le:15 also works)
Human, vigorous Unknown and partly hidden in the shadows, the statue portrays a tall and vigorous human of unclear age. ... "Societas Eruditorum" Could be a reference to "Societas eruditorum incognitorum in terris Austriacis"(The Society of Anonymous Scholars in the Austrian Lands). [20]
Human, screaming A layer of ice covers it completely and an aura of cold seems to be emanating from within. Just below the surface you can make out a human face screaming in agony. "Where are the frost giants I've begged for protection?" Wait on Decreases speed by 5 "The air in your lungs seems to be cooling to an almost unbearable level. Ice crystals are starting to form on your skin and you gear. Perhaps you should leave before you freeze into a statue yourself." May refer to the song Too Late: Frozen by Typo O Negative [21]
Sisters Of Great Sisters "AN GI NA" Kick Increases Charisma by 1 and statue disintigrates. "You feel friendly" It is a reference to The Great Giana Sisters [22] game. "AN GI NA" is an anagram of "Gianna" (misspelled heroine's name)
Rene Delicately carved from dark green granite, this huge brute of a man stands leering over you. ... "Rene, Son of Rel. Master of Blades, Bringer of Storms." Kick Drops a wicked eternium two-handed sword of lightning. "A two-handed sword appears at the feet of the statue!"
Scarabs It is a stunning sculpture of a swarm of blue scarabs, accented with gold and precious gems. No inscription Wait on Increases Dexterity by 1. "You feel very nimble"
Tarandil On the weathered stone you discern the features of a tall elf, his right arm holding a lute, his left distorted in a mass of tentacles, a sly grin on his scarred face. "All hail Tarindil, master of music, embracer of ChAoS!" Wait on Charisma+1, Learning+1.

Corruption or corruption removal. See notes.

"A dark and enchanting tune hangs in the air for a moment, and you feel your mind wander to forbidden places." Effect is likely bugged in r49: PC with no corruption got 1 corruption level. PC with about 0.5-1 corruptions got some corruption points removed. PCs with 5 and 17 corruptions were cured from all corruptions (but left with some corruption points).
Gargoyle You find a gargoyle entombed in unadulterated terror. The statue smells of the sea. The statue has a marble ring of the fish in one of its hands. "If found, ship to the Gorgades Islands." Pray No effect No message Gorgons [23] from Greek mythology were thought to live on the Gorgades Islands (which may refer to modern Cape Verde [24]).
Man, bound It portrays a man bound to the earth with heavy chains. "A name is an omen." Kick Earthquake "The whole level is suddenly hit by a violent earthquake!"
Man, on arch It is a statue of a man with lifted arms, standing

on top of a large gate-like arch of unhewn white stones.

"Off we go!" Wait on Several (2 to 4 observed) swordsmen appear next to the PC.
Elf Woman It represents a young elven woman holding a fairy dragon in her hands, exquisitely crafted from mithril. "In Memory of Thecla" Wait on Summons a tame fairy dragon "A tamed fairy dragon appears."
Man, Lawyer The statue seems to want to talk to you, its half-grinned face seems to follow you around the room... eventually the statue begins to explain various countries' corporate and civil laws. You are bored enough to fall asleep! "this is a lawful statue" Kick You feel corrupted! Enough to receive one corruption.
Jussi Viinikainen It pictures a long man in a robe whose gaze is at the distance and who is holding a thick book in his hand. The man has the symbols of the elements engraved in the back of his robe. "Jussi Viinikainen, pioneer in elemental research" Wait on Player is prompted to read a set of runes on the foot of the statue (y/n); various effects are available depending on PC's Learning score (temporary confusion, receiving intrinsic random elemental resistance, resistance to all elements, or failing to read the runes to no effect at all) When gaining resistance to all elements: "You understand the runes. You now fully comprehend the principles of the elements." One time only: if you decline to read the runes another attempt is impossible.
Dragon, Crystal It resembles a beautiful dragon, carved from the purest crystal. The statue glistens in the light like a myriad fires. "Humble yourself before the lord of the mountain lake!" Pray Grants +2 Learning No message Reference to Guy Gavriel Kay's Fionavar Tapestry series.
Warrior, Ancient It is a great hulk of black obsidian, depicting an ancient warrior. His armor is dented and battered, his sword broken, and his shield split. He is covered in scars from numerous battles. ... "Though ye be doomed, if ye have breath, fight on." Pray If not already doomed: dooms the PC and summons an air grue, a water grue, and fire grue and a stone grue around him/her. The statue also gets destroyed.

If doomed: grants paralysis resistance intrinsic and destroys statue.

If doomed: "The statue crumbles to dust! You feel incredible surge of strength pass through you."
Bard It resembles a bard with a long-necked lute with four thick strings. "Bow your head to lowland vibe" Pray Generates lute {Lakland} (was uncursed/doomed and L+ crowned) The 'lute' described is more than likely a bass guitar [25]
Man, Grining It resembles a grinning man with a pamphlet under his arm, counting on his fingers. It is made from pyrite. You suspect he cheated. "When speed must needs exceed" Kick + 1 Speed None
Cube It's a hollow square cube that you can see into from the top. The statue is half filled with middy [sic?], lumpy water. "Waste not, want not." Kick Splashed with sewage, -2 Pe Dirty smelly sewage spills all over you!
Frog It resembles a bipedal frog with one foot much larger than the other in a martial arts pose. "In memory of Ribby - the foot of justice and beloved king." Kick You'll slide one step from statute. No health damage. The statue rotates on its base and kicks you back! You tumble along the floor after being hit by some strong force!
Foot It resembles a foot. "Artist unknown" Kick (repeatable) None other than a message? "A booming voice shouts: "Ow!" "
Nothing You don't notice anything unusual. Or do you? "Please return to the finder." Wait on (repeatable) Unknown You feel happy and content.
Old Hag It resembles a decrepit old hag, dressed in tattered rags. No inscription Wait on May make the PC Sick. You feel decrepit. (Specifics not known - done to a Dark Elf Ranger, further testing needed.) GnWiz do not suffered
Caryatid A caryatid stands here, holding the ceiling above you. "Do not kick." Kick Earthquake on whole level. The whole level shakes violently. Seems to produce much more destruction that just one casting of Earthquake spell.
Cenotaph It appears to be a cenotaph for an adventurer who lost her way in the dark. "Tipi Marjukka Ainas, YASD" Kick Generates a wand, scroll, or amulet of light The statue crumbles to dust! Suddenly an item is lying on the ground YASD — a commonly used acronym in the ADOM community — means "Yet Another Stupid Death"
Warrior It is a very lifelike stone warrior standing a shield raised on defense and a sword readied to strike. "Sir Archenon the gremlin slayer. Arch Gremlin tricked him to petrify himself." Kick Generates a long sword with a prefix or suffix. Prefixes observed: fickle, white, wicked, ashen.

Suffixes observed: mayhem, defense, penetration, fumbling, devastation.

Nothing It appears to have been crudely hewn out of some sort of indistinguishable material. It doesn't seem to resemble anything in particular. The only thing that is definite about this statue is the unmistakable feeling of dread it inspires in you. There appears to be an inscription at the bottom. Are those... claw marks? (There appears to be no actual inscription. The above is part of the description.) Wait on Breaks, releasing a chaos monster, that depends on PP. chaos rat (PP < 40);

chaos plague bearer (PP > 40);

chaos spawn (PP > 80); chaos knight (PP > 160); writhing mass of primal chaos (PP > 320); balor (PP > 640). Also drains all PP.

Jalmag, troll warrior The statue seems to depict a troll, unlike any you have seen. Tall and lean, it almost looks like a giant elf. Covered in heavy armor from head to toe, gigantic sword in one hand and massive shield in the other. You imagine he must have been the very symbol of invulnerability in life. "R.I.P. Jalmag, the troll warrior, grand master smith, felled by the Lich King." Wait on Chance to fix rusty or broken equipped item "You hear a voice in your head: "YE'LL NIID HELP! 'ERE! BASH DEM GUD!" Kicking, stepping on, nor praying with high elven archer seems to doing nothing. Stepping on with dark elven beastfighter resulted in voice.
Wine Bottle It is an obsidian statue of a wine bottle, faintly glowing from within. "Em ebibmi! (it's "imbibe me" backwards)" Kick Generates potion of gain attributes or potion of cure corruption; destroys the statue "The statue crumbles to dust! Suddenly an item is lying on the ground."
Acheatarus Acheatarus, Demigod of the Unspoiled "It is better to have loved and lost than to never have loved" Wait on Summons a tame monster
Headless It has no head. Its outstretched arms still bear the weathered symbols of some long-forgotten noble's hall. "No more can any man achieve than this." Kick Destroys the statue "The statue crumbles to dust!"
Cat It is the skillful carved cat from a dark wood. Black eyes of the statue seem to glow a bit of light. No inscription Kick Drops two worthless pieces of white glass "The eyes of the statue drop to the floor. Suddenly some items are lying on the ground."
Swordsman It is too worn to be sure, but it resembles some ancient swordsman, standing at attention. No inscription Kick Generates a mithril long sword "The statue crumbles to dust! Suddenly an item is lying on the ground."
Soirana, troll bard Soirana, troll bard while in the midst of deadly singing accompanied with bone breaking clubbing. "Eto po lubvi" Pray Generates a gem "Suddenly an item is lying on the ground." Inscription refers to a song by Russian band Mumiy Troll [26]
Mindcrafter Shod of silver, it resembles a proud and haughty looking human, who bears the symbols of a mindcrafter. "Only those who can keep their thoughts focused in one place dare approach." Wait on Trains Learning if stat is high enough You hear a voice in your head: "Welcome student, I have much to teach you...". The statue crumbles to dust!


or

"Don't waste my time!"

Gnome It appears to be a small iron figurine of a cowled gnome. Unremarkable in appearance yet seems to be posed in a way to suggest he is hiding something from view. ""I'm the jinx, so what?"" Kick curses
Lemniscate A jumble of stone and metal loops intertwine into a wondrous figure. While seeming chaotic, the eye is quickly drawn to follow the curves, building a pattern as you continue to gaze at it. A tear leaks from the corner of your eye. No art has ever moved you this way, you cannot move for fear of losing this moment. "Understanding eternity takes time." Wait on Briefly paralyzes, restores PP "You are flooded with power!"
Woman, weeping It's a rather creepy statue. A female form in alabaster, dressed in a all-encompassing habit, praying. The palms are pointed towards her though, trying to cover her eyes. Her eyes are carved ivory and in each corner is a tiny sapphire - as if she were weeping. "Don't blink. Blink and you're dead. Don't turn around and don't blink." Refers to the Weeping Angels [27] from the TV Show Doctor Who. The inscription is a quote from the Doctor regarding these entities.
Siren A solitary siren sits atop a pile of bones. No inscription 1.2.0pre23, crashed the game when steping on it. Caused a Crash in 1.2.0. Seems fixed in Release 60. Surrounded PC with hostile monsters in Steam up-to-date on 12.11.2017
Leprechaun It is a beautiful emerald statue of a miniscule, grinning magical figure with glistening amethysts for eyes. It seems to brim with magical energies. "A rare, elusive 'leprechaun', that hails from a beautiful realm far far away" Kick Grants teleportitis to the PC None
Changing Shape Colored a deep blue, its shape seems to change while you look upon it. "Take Each Random Little Opportunity, Boldly." Kick if boots are on - bless them, else damages slightly "Your feet feel relaxed" / "Your feet hurt."
Unicorn, white marble It resembles a winged unicorn made of pure white marble. "Blessings I give to all my faithful students." Pray Blesses all spellbooks in backpack Reference to the character Princess Celestia in My Little Pony: Friendship is Magic.
Dragon, cat -sized A cat-sized dragon with an impish grin and carved of near-translucent crystal lies at ankle level. "To Glitterwing, true companion, fearless hunter, and reckless troublemaker." Kick Fairy dragon appears Status (hostile/non-hostile/tamed) of apearing monster depends on charisma score. Apparently with 9 charisma it apears non-hostile but becomes hostile when action taken.
Unicorn, mane of stars It's a winged unicorn with stars in its mane. "Huzzah!" Pray Grants the see invisible intrinsic "You are blessed by the goddess of the night!" My little pony reference to princess Luna, from the episode, "Luna eclipsed". [28]
Man, tubby It depicts a small, tubby man, carved from a dark wood. He is smiling widely and carries a small cask under his right arm. "I share freely" Kick No noticed effect "A murky liquid spills from the cask making you drunk."
Man, larg-bodied It has the shape of a large-bodied man; with short arms and stubby legs. A round head is topped with a thin streak of hair like the fin of a fish. "VISCERA" Kick Dooms "Oops." Likely a reference to Nelson Frazier, Jr
Boot It oddly resembles the shape of a boot. "For every action, there is an equal and opposite reaction" Kick Knocked back one square The statue kicks you back. You tumble along the floor after being hit by some strong force! Reference to Newton's 3rd Law [29]
Ratling Warrior This appears to be a statue of a ratling warrior of exquisite craftsmanship - you can make out the tiniest wrinkles on the creature's skin, the tiniest dents on its scales and armor. The figure is standing on one knee, cowering under a shield and stretching an arm as if attempting to strike an imaginary foe. There is a mixture of horror, desperation and anger on the ratling's face. "Do not touch." Pray Curses, destroys the statue "*FOOLISH MORTAL! I'M NOT HERE TO BRING BACK TO LIFE YOUR PETRIFIED RATLING FRIENDS* The statue crumbles to dust!" Effect occurs whether you are a ratling or not.
You You are shocked to discover it's a statue of you. The lifeless stone eyes seem to meet your stare. The effect is quite disturbing. "Erected in memory of a brave adventurer, Rest In Peace." Wait on Dooms PC You feel as if your final days are upon you!
Sphinx it resembles a winged lion with the head of a human woman. it seems to be carved from solid granite and has a sculpted book before it. "Knowledge is another form of power" Pray +1 Learning You feel knowledgable [sic].
Humanoid, Large eyed It is a mere meter tall, and depicts a vaguely humanoid creature with large eyes, tentacles and eyestalks. "Alien's corner of quiet and guilt." Wait on Mutes the PC.

[temporary - same as harpy corpse?]

Jackal, obsidian It appears to be of a large jackal carved out of jet black obsidian with sparkling rubies for eyes. "I guard the veil against any who would violate it." Kick "You hear the steps of the royal guard"
Weasel, two-headed It depicts a weasel with two heads. Each eye is made from different kind of gemstone. "Ancient Weasel of Eldritch Knowledge." Pray +2 Learning, -1 Charisma "You absorb eldritch knowledge and are altered by it!"
Druaf Momo Olepisk It resembles a middle-aged man wearing a wizard's robe. Curiously, he is holding a shield in each hand. The shield wielded in his right hand is silver with a circular motive. His other shield is almost perfectly black. You can feel experience and power radiating from the statue. "Drauf Momo Olepisk, a sorceror from a land quite nearby." Pray Generates a large shield "Suddenly an item is lying on the ground."
Elf, horrified It depicts an elf with a look of horror frozen on her face. "Not all petrification goes bone-deep." Kick Summons a hostile writhing mass of primal chaos.
Rabbit, gold It resembles an ancient white rabbit, hewn from gold smelling faintly of frankincense. "Cas Go Par!" Kick Unknown "<PC's deity> mumbles Myrrh..." The references to gold, frankincense and myrrh could be a reference to the gifts of the three Kings / Wise Men at the nativity of Jesus
Cat, elegant Small and shaped like an elegant cat, stretching, it is made of crumbly white alabaster with pink ruby eyes that seem to sparkle as if lit by a ray of sunlight. "Willow, a gentle creature, she loved the light and we loved her" Unknown (Doesn't respond to kicking, prayer or stepping on. Zapping a wand of light, casting light, nor using a crystal of light have any noticeable effect.)
Cat, silver Carved from a block of silver leaf jasper, it depicts a lightly built, short-haired cat with friendly slanting eyes and dark points. "Requiesce cat in pace Darion" Wait on Removes curse
Argyll It appears to be of a robed figure, holding a tome. "Argyll, the compiler of odd tales" Reading Generates a book(?) Character was bard with 21 Le and 100 literacy. Generated book was teleportation.

Another character: trollish barbarian with 24 Le and 85 literacy. Cursed book of magic missile was generated.

Another character: dark elf ranger, 14 Le, 40 literace - uncursed book of bless.

Trolls, cocky A band of cocky trolls, petrified by their encounter with reality, still appearing to smugly surveying.. their surroundings with upturned noses and blind eyes. "In memorandum of things best forgotten" Wait on Decreases stats; changes of -1 Str, -1 Le and -1 Wi were observed "Your morale drops" Seems to be a reference to internet trolls [30]
Heart The mottled black and red eudialyte stone has been polished and sculpted into the shape of a giant, humanoid heart. "I want to hear your screams!" Wait on Decreases alignment (N- to CN, NL to CN and N= (crowned) to N- observed); alters stats: +1 Le, +3 Wi, +4 Dx, -1 To, -2 Ch, -3 Ap, +2 Pe "Your eyes blacken momentarily as the statues darkness infuses you. You feel changed."
Gas An ashy blackness pulses over the statue's surface, giving it an appearance of gaseous immateriality. "There's no smoke without fire!"
Man, athletic The dark statue of a tall, athletic man lies ahead of you. A mischievous smile is frozen on his face, and bright green eyes seem to be fixing you with their gaze. "I do what I try what I am" Wait on -5 St, -5 To, drops the amulet of petrification resistance "As you get close to the statue you feel weak, and your vision blurs slightly. As you slump to the ground, tired and dizzy, you see the color of the statue going from dark to fair, coming to life in front of your eyes. The man whispers his thanks in an insidious voice, and disappears."
Teacher Apart from the two rubies it has for eyes, it is made of pure black onyx, absorbing any light that touches it. Its eyes remind you of someone from ancient times, someone whose face you remember seeing in old tomes... a scholar or wizard, perhaps? "Teach and be taught!"
Man, thinly built It is of a thinly built man huddled as if to squeeze through a narrow gap. He leads with a stone crossbow, held at arm's length. No inscription Wait on +4 Pe, temporary "You no longer feel afraid of the dark."
Dwarf, Ranger It appears to be a fierce dwarf ranger cunningly depicted out of a massive block of granite. "ye'll need more than that to hurt me!" Kick Does ~88 points of damage without killing the PC (reducing it to minimum 1 HP) and increases Toughness by 1 1 PC was reduced to 1 HP, another from 202/202 to 114/202. Both didn't die, and got 1 To.
Kobold It seems to be a wooden carving of a kobold holding a baby human "To Mkita, for not eating my baby" Pray "You feel strangely drawn towards kobolds..." is displayed. It is currently unknown what this means.
Dwarf, gambling It depicts a heavily armored dwarf playing dice against a gnome, who's just lost his armor on the game. "The luck is the greatest armor of all." Pray Unknown None
Kobold, Alabaster A kobold carved of pure alabaster takes a defensive stance, tightly clutching a spear. Despite being wounded, the small creature's face remains brave and determined. "Small But Fierce" Kick Injures the PC; no other noted effects

[v1.2 removes part of current Health, adds to max PowerPoints. Not know if its permanent of temporary effect]

"You feel weak and overpowered." A reference to the Kobold Quarterly[31] magazine, now out of print.
Cat, Giant A giant cat is poised as if to pounce, carved from white marble with inlaid stripes of tiger's eye across its back and tail. Its eyes are blue sapphires and glow faintly! "Sharaleo" Pray Grants see invisible intrinsic "Your eyes tingle."
Ubun, Fire elementalist This is the statue of a tall human magician, clothed in a long tunic. A decided expression is on his face, and a beautifully-sculpted flame raises from his extended hand. "Ubun, the fire elementalist. Igne nature renovatur integra." Pray Triggers a fireball/explosion on the statue's square "A huge fireball explodes!"
Twig the Lurker It is covered with dense foliage but you see a gleam of sapphire underneath. "Twig the Lurker!" Kick Gem is put where you were standing (Sapphire or random?) "The foliage rustles. Suddenly an item is lying on the ground."
Dwarf, It's a dwarf raising his ale mug up high! "Beware the consequences!" Wait on Confuses for couple turns "Your head hurts!"
Boy It resembles a young boy with chestnut brown hair cropped in a bowl cut. "Yllib LLa Reve!" Kick Generates a wild cat
Human It depicts a slight human with unruly hair and skewed glasses that seems to be staring intently at some arcane chalky scribbles on a nearby wall. "The rule of thumb!" Wait on PC gains marks for all weapon skills (including missile weapons and shields) "You gain some surprising insights into your combat abilities."
You An exquisitely detailed marble sculpture. It is a perfect likeness of you! "No adventurer will ever match this peerless original." Wait on Summons a hostile doppelganger "Suddenly a copy of yourself appears."
Man, ugly It resembles a very old and ugly-looking man. His eyes seem to glow a tiny bit and figure itself feels like alive when caught by a peripheral vision. The long dead body of an adventurer is nearby. "Koschei (might be obfuscated to hide the relation to the Koschei the Immortal)"
Beast It seems to resemble some variety of terrifying quadrupedal beast. Intricately crafted from granite, razor-sharp hooked claws and needle-like teeth catch your eye. "Beware! A great and perilous beast hast been entrapped within." Kick Summons a hostile wild cat "A hostile wild cat appears."
Man, disapproving It looks like a man wearing immaculate clothes. You feel as if he disapproves of your beggar look. It seems to look right into your soul. You feel as if it knows all your deepest secrets and desires. Better than you do. "You rang, Milord?" (Milady if female) Unknown Activation methods attempted: kick, pray, read spellbook, read scroll, zap wand, cast spell - no step-on message
Gnome, happy It resembles a happy gnome that enjoys the flow of the nature forgetting the violent ways of the wilderness. "Respect the things greater than the races of Ancardia."
Bear It resembles a small brown bear, crafted from rough hewn wood. "Clifton, the bear" Pray If doomed summons ~6 hostile grizzly bears, else summons a tame brown bear
Amazon It depicts a young barefoot amazon clad in wolf pelts about to ready an arrow onto her longbow. Her long locks of hair and delicate features are so gracious and lifelike you are immediately struck by her beauty. No inscription Kick Puts PC in sleep for about 20 turns and the statue disappears. Restores full HP and PP. Suddenly the statue shudders and appears to shake itself back to life!

The long locks of hair turn jet black and flow about as she shakes her head fighting the drowsiness of an age old sleep. Her head then turns from side to side looking for prey. As she spots you she quickly readies an arrow! For a second you feel a strange sense of fascination as her eyes look deep into your eyes. Before you can react the magical arrow hits you in the chest! Waves of magic pour over you. You feel drowsy. You smile before helplessly falling into a deep sleep.

Nothing It is very smooth and completely dark, when you touch it you feel a small carved impression of a boot. "Feel the power in your feet" Kick Grants the see invisible intrinsic "Your eyes tingle"
Minotaur It seems to be a male minotaur dressed in leather and female orc in plate mail holding hands. "Mutabull, Minotaur Druid, and Hafwenharu, Orc Paladin" Pray Removes unnatural age; the prayer will also be heard by the PC's god in this case "You are reminded of a love from your youth."
Man, tall It portrays a tall man, his face alight with wonderment, his eyes lost in the contemplation of knowledge that transcends the mundane world of commoners. .. "Phi Ricardus Nnam, human archmage, melder of lights and ambers, 918--988" Wait on Increases Learning (at least 1-4 points) "You feel enlightened!"
Nothing It seems very thankful. "Welcome back" Wait on Generates a mithril weapon of the most skilled type "Welcome back to our lands. You are instrumental to our future. We could not have done it without you." The statue crumbles to dust! Suddenly an item is lying on the ground. Effect was observed with a level 16 gnomish barbarian who was fighting with his heir gift (brutal two-handed sword), and a mithril two-handed sword (+6, 3d5+6) [-1,+0] was generated in this case. A level 11 hurthling barbarian wielding an adamantium scimitar received a cursed balanced mithril broadsword (+7, 1d7+5). A lvl13 DE Wizard wielding Skullcrusher received uncursed mithril dagger (+0, 1d4+5). A beastfighter (most skilled in unarmed combat) received a piece of mithril ore. Level 8 orcish barbarian wielding adamantium short sword got (+1, 1d8+4) mithril spear because polearm weapons training was at level 5, and swords only at level 2.
Humanoid creature It's a strange humanoid creature with fourteen outstretched arms. They almost look as wings of a skeletal angel. # of the hands are clenched into fists. [# equals to the number of scrolls the statue was given previously.] "Scroll of literacy check recall center."
Humanoid Warrior It is the crumbling remains of a humanoid warrior mounted on a small horse. It has been carved from brittle sandstone. "... ... Friendship ... ... ... ... Wait on Statue breaks, temporarily boosts Charisma by a small amount "You feel friendly."
Thea Maris Cheerful maiden in a dynamic pose of a dancer, cast from pure gold, her back straight, arms held tight to her body. As you adjust your sight, you notice that light flickering ghastly on statue's fair features makes an illusion of rapid legs' movement. "Queen Thea Maris, The Butterfly Dancing with the Morning Star" Pray Speed boost "You quicken!" (similar to the potion of the boost speed)
Horseshoe It is in the shape of a huge, golden horseshoe. "Luckyshoe" Wait on Adds Lucky intrinsic "You feel lucky."
Human, foppish A foppish-looking human is carved into the marble. His grin is somehow infuriating. "LATE TO BED AND EARLY TO RISE GIVES A HERO SAGGY EYES" Kick Generates several (3-4 observed) scrolls of amnesia
Wizard, Casting Of a wizard who looks as if he was about to cast a spell. "Call upon me when it seems magic may be the only remaining answer." Unclear Possibly causes PC to go into berserker mode and encountered on same level as White-Mask
No'Grok, trollish healer It represents an old trollish figure wearing shamanic clothes. "No'Grok, healer of the Keg'Sham tribe, but also a fervent follower of Vagrak." Pray "You feel both healed and corrupted. You feel corrupted." Corrupts PC PC was a level 4 grey elven wizard. Apparently also causes damage, since he died immediately afterwards. Cause of death was "broke his leg while kicking at the air." Level 8 trollish barbarian was corrupted by activating, but didn`t get corruption.
Snakes It resembles two entangled snakes in the act of swallowing each other tail, shaped like a lemniscate. "The only way life can stay alive is to devour other life. Nothing is sacred." Nothing happened when illiterate male barbarian troll, clvl 5 steped on nor when kicked the statue. Need further investigation.
Gnome, blue stone It resembles a gnome carved from a clear blue stone. "In honor of Twidgie - emissary to the trolls and cryomancer of legend." Kick Get some castings of Frost Bolt. "You feel cold."
Drakeling, corrupted A statue of an immensely corrupted drakeling appears to be staring at something. "You cannot outrun your destiny." Wait on Temporarily boosts speed
Phoenix, crystal It is a crystal phoenix, filled with magma and

glowing a violent red.

"HS, AR/SLDR, TBAB, C"
Sven T Sexgore Crafted from marble it depicts a human in strange garb - one hand bearing a flame and the other an orb. "Sven T Sexgore: Mad Genius & Part-Time Deity" Pray Grants fire resistance intrinsic
Dwarf This crudely-chiseled statue seems to have been carved by the very dwarf it was meant to depict... after he had a few too many dwarven ales. Either he had serious genetic problems or he wasn't a very good sculptor. "Orris, dwarven monk" Kick Confuses, makes drunk, reduses healing rate slightly "You suddenly feel more powerful and quite dizzy. Also, your foot hurts. You can think clearly again."
Raven It has a look of a raven on the pedestal of pure black onyx. An old tome is lying under the claws. "Those who follow the path of Elendar may be enlightened." Pray Dooms, PC is randomly teleported away from statue "You are suddenly lost. Suddenly you stand somewhere else. You hear raven's caw from a distance. You feel very bad about it."
Rodent Made from a single slab of black ivory, it represents a large rodent. A marmot, or perhaps a groundhog. Hard to say, since it's been subject to extensive weathering. The animal seems to be wearing some sort of spectacles, and holds in its paw a device that resembles a sundial. "So the eve of tomorrow is the eve of today..." More than likely a reference to the rabbit from Alice in Wonderland
Egg It resembles a huge egg, hewn from polished granite. "Only a fool would try to break me." Kick Damages the PC by half of current HP; grants -1 Strength One-time message: "The statue does not budge."
Creature It depicts a dark-hooded creature. You cannot discern its race or class. Beneath the flaps of the cloak you catch a glimpse of something shiny, metallic. No inscription Kick Teaches Backstabbing to the PC. If it is topped, teaches Stealth. Dooms lawful PC. "You feel more skillful." neutral GnMo was cursed
Horsemen A gleaming obsidian statue depicts a crowd of horsemen on top of a hill, with a crowd of goblins cowering around them. "Never forget the Conquest." Pray No visible effect The sound of hooves trampling the ground rushes into your mind... and fades out with the sound of goblins gnashing her teeth.
Goat It looks like a goat. No inscription Wait on Increases strength (?);

Blesses character

"You feel supported."
Hurthling Archer It resembles a hurthling archer, apparently eating some sort of cake. "Omno mune zur!" Pray Increases satiation (~ 1500) "You feel slightly more satiated."
Cat, obsidian A magnificent obsidian statue of a large cat sitting on top of a chest, one paw extended. "Ilmaleipuri, the hungry one" Pray Grants fate smiles intrinsic; the prayer will also be heard by the PC's deity "The statue seems to smile at you for a second. You smile back."
Woman, princess It resembles a beautiful person with long hairs, statue is made from light pure marble without any marks of aging. It makes you wonder about the legendary princess of Ancardia. "Those who meet my fallen knight will know the strength of the toughest love." Wait on Summons a moloch with a random name
Fawn it resembles a fawn, somehow always staring at you, almost as if its turning its head when you look away. Initially the statue appears to be made of wood but upon closer inspection you realize it is marble, masterfully carved to look so. "From dust we are created and to dust we shall return." Wait on -1 St; possibly dooms; other effects, possibly item destruction? You feel weaker. Some dust drizzles from your backpack! You feel very bad. A voice booms: "FROM DUST WE ARE CREATED AND TO DUST WE SHALL RETURN" The effect may sometimes be just a strength loss, without the other effects or message text past "You feel weaker."; the actual effects triggered may depend on certain factors that are not yet known.

Sometimes there are no effects whatsoever, and there are no messages generated as well.

Drakeling, old The statue depicts an old drakeling carrying a tome in one hand and a polearm in the other. "Herald of Lore" Cast spell Destroys statue and summons a giant rat in its place, which carries a spellbook of whatever spell was cast.
Leopard It is an ice sculpture of a leopard with sapphire eyes. The ice glows from within, there is something trapped inside. "Snow falls gently as silence reigns in a moonlit glade and pines bend to winter" Kick Generates two rings of ice
Gnomes It depicts small figures, possibly dwarves or gnomes, boarding a strange-looking ship inside a large cave. The statue is made from rough stone. It seems to be unfinished No inscription Pray Unknown
Nothing A peculiarly formless statue.

or
A nondescript statue.

"THE UNKNOWN GOD" Pray Drops scroll labelled WEJHA for some. Conditions not known Scroll contains large text about prayer. No known effect. When prayed at by level 6 Orc Beastfighter in UD:2, dropped a scroll labeled "WEHJA". Also Troll Wizard. When read, the scroll says, "... contains a very long text. Do you wish to continue?" If cancelled, the scroll is still used.
Druid Wrought in hardwoods, its intricate detail evokes a druid with lightning bursting from the fingertips. "At last, we meet again..." Kick A hostile druid appears The druid encountered had around 20 DV, and hit twice per turn. Not recommended to attempt in early game.
Creature It looks like a combination of dragon, human, and octopus with tentacles hanging from its head. It reminds you of some ancient god, sleeping at the bottom of the ocean... "Kneel before me when the stars are right and I shall

conquer the worlds!"

Pray Hostile least daemon appears Reference of Cthulhu, a fictional deity created by writer H. P. Lovecraft and first introduced in the short story "The Call of Cthulhu", published in the pulp magazine Weird Tales in 1928.
Raven It is a tiny statue of a raven, which you might have missed amidst the rubble had you not been looking closely. "The secret to vast riches is to save every penny" Wait on Generates one gold piece
Nothing A statue that defies description, beyond simply a column of power, rising hundreds of feet into the air. "Adventurer beware" Wait on Reduces HP to 1 and restores PP to full "You feel full of power and very weak at the same time."
Nothing It seems to flicker in and out of existence. The few glimpses you manage to catch of it seem to radiate in all the colors of the rainbow. "Seeing is believing" Wait on (repeatable) Grants the see invisible intrinsic
Fountain A stone reproduction of a water fountain stands before you. "Behold water immemorial, adventurer: not frozen but held in time." Wait on Paralyzes the PC for about 15 turns "Suddenly you feel as if were frozen in time!"
Humanoid It is a crude humanoid figure, clutching a sword in one hand and a strange, angular goblet in the other. "An Adventurer is You!" Pray Generates a potion of booze This is the logo and tagline of browser-based RPG Kingdom of Loathing [32], in which booze is an important item.
Wyrm, Ancient Chaos Brushing away the dust of ages you reveal the terrifying visage of an Ancient Chaos Wyrm. A shudder passes through your body as a whisper enters your mind "fear me mortal, for I am your doom". Kick Corruption
Structure It resembles an infinitely complex crystalline structure which glows with a strange light. "gatataatccataccattatcat" Wait on Corruption The inscription is a gene sequence.
Lol'th It resembles a vaguely elven female figure, formed from dark granite. A strange, wavering symbol is etched into the figure's chest. "i' alkar en' Lol'th" Wait on Summons a dark elven priestess. Priestess was companion for Troll Chaos Knight and chaotic Dark elf Necromancer.
Zombos Carved out of black rock, it appears to be a vile zombie with fearsome plated armor seemingly bolted and nailed into the its.. decaying flesh. Curiously, the statue seems to radiate heat. "Zombos, Lord of the Undead" Kick Triggers a fireball / explosion at the statue's location. Zombos also appears as a boss monster
Gnome, Hero It resembles a gnomish hero. "Fus Roh Dah" Pray Fire resistance "You cool down."
Cat, feral It resembles a wiry, spotted feral cat, made from sandstone and black granite. Its emerald eyes seem to stare at you! Wait on Temporarily boosts speed "You quicken!"
Vampire It appears to be of a tall human of ambiguous gender, its long fangs the only clues that it is in fact a vampire. There is what looks like long dried blood on the fangs and looking into its eyes you feel a strange desire to add some of your own to the stains. "feed me and I shall help you to feed from others." Wait on Permanently reduces max HP by 20; a murderous adamantium broadsword of vampirism is generated on the square "You feel some icy force feeding on you!"
Jayne Cobb It depicts a large man with a goatee and a stern expression. Wherever you move his eyes seem to follow. His clothing is very ordinary save for a fuzzy hat which seems out of character. In his hands is a very sophisticated and powerful crossbow with the name "Vera" etched in the stock. The statue appears to be made of incredibly strong ceramic. "Jayne Cobb" Pray Generates gold pieces, 5258, 6602, 7357, 8322, 9000 and 9904 observed. Jayne Cobb is a character in the show Firefly. One of his weapons is named "Vera".
Orc It appears to be a ferocious-looking Orc, carved from jade. It wields a greataxe with a bloodthirsty grin. "The Warlord's Fury" Pray If non-chaotic and non-orc: summons 2-4 hostile orcs

Otherwise: summons a tame orc

"Suddenly some orcs appear." or "A tame orc appears."
Human, ugly It is of a rather ugly human in an unusual pose. Its face, which is turned to look behind it, is twisted in fear. A large, lumpy sack is clutched in its right hand. "Such is the fate of those who would steal from Solia the Wizard." Cast spell Generates items "Absorbing some of the magic from your spell, the statue comes to life. "Mercy!" The thief hurriedly empties his bag and scurries away.

Suddenly some items are lying on the ground."

You Oddly enough, this marble statue seems to resemble you. "Fragile" Kick Reduces Appearance by 1, damages as if you kick yourself "The kick breaks off a piece of the statue's nose and a jagged crack runs across the statue's face. A few seconds later your own head rocks back from an invisible blow that breaks your nose."
Humanoid, holding wand It is made of aged and splintering wood, the details too faded to make out. It appears to be holding a wand. "Mage's Folly" Cast spell?

(Light was cast once)

Confuses, possibly other effects too. "You feel as if you have blundered"
Nomad It depicts a spear wielding nomad, its hair painted blue. "Saito Wanderer Doomwarder" Cast spell Blinds the PC? "You think you smell sweet ferns."
Man, emaciated It is an ancient, cracked statue of an emaciated man, bent with age. "I will show you fear in a handful of dust." Kick Ages the PC by 10 years "You feel older." 10 years has been observed for a ratling and a dark elf.
Humanoid, winged It's of a winged humanoid with upraised hands, made of polished marble. "Reach the sky." Wait on Speed+3.

Also temporarily boosts speed hugely [200 extra points were recorded]

"You feel as if the sky has become somewhat closer!"
Elf and Orc Kissing An elf and an orc kissing, hewn from granite. "John and Stephanie forever" Wait on +1 Mana "You feel more powerful."
Dragon, squatting It appears to be a squatting dragon in hewn slate with its tail coiled around the base of the statue. "Claws of dragons - humans' blood streaming - unseen sparkling..." Pray Mutes (permanently?) "You suddenly can't speak any more."
You It depicts a <PC's race> <PC's class>. "<PC's name>" Kick Deals damage to the PC "You hurt yourself."
Barbarian It's a rough barbarian in thick furs. He's clutching a mirror with both hands. "The way home" Kick Unknown None
Lamp It resembles some type of oil lamp. No inscription Kick Grants a wish, or summons a hostile djinni. "You have been granted a wish." or "A hostile djinni appears." Sadly can only be kicked once.
Man, average It appears to be a medium sized man in a bowler hat, vest, and bow tie. "Nobody No-one was here." A reference to Doctor Who audio stories? [33]
Strange Item It resembles a large si. No inscription Pray Increases random attribute by 10 permanently "You feel trained."
Angel It is shaped like an angel with her wings spread, sculpted in white marble. "Rest, ye righteous." Wait on One off full healing for non-chaotics. "You feel great."
Hoagie the Cave Wizard It appears to be a sculpture of a hungry-looking wizard. "Here lies Hoagie the Cave Wizard, entombed by hunger for all eternity." Wait on Either hugely boosts the PC's satiation, or increases it straight to Bloated (variable amount) "You feel bloated!"
Trout It resembles the trout jumping out of the river. "Thanks for all the fish" Pray ? "The statue laughs at you" A reference to the Douglas Adams books [34]
Ozymandias Two great legs of stone and a fallen, frowning head are all that remains of the once proud sculpture. "Look on my works, ye mighty, and despair!" Kick Temporarily blinds the PC (~6 turns) "You hear a distant scream of rage, echoing across the centuries. Suddenly a hot gust of desert wind blows sand past you, stinging your eyes. You are blinded!" Reference to the poem "Ozymandias" by Shelley.
Ratling It depicts a life-size ratling in gray stone. All of its facial features appear to have been chiseled off and sanded over. "Know me not, and I will not know you." Pray dooms the PC if Dexterity < ~50, else advances stealth, grants +2 Dexterity and temporary invisibility "For a moment, you feel something looking at you... and eyes you with contempt as it notices you / but its gaze seems to pass over you." The statue always depicts a ratling, regardless of the PC's race.
Dogbreath It appears to be of a grizzled Gnollish Warrior. "Dogbreath, a mighty warrior of the hidden fortress at Deegi'eff" Kick +St +To for ~20 turns, then +1 St +1 To -1 Le -1 Ma permanently. "You feel different." A level 9 L Dwarven Barbarian PC with 30 str and 29 tog got a temporary boost of +3 str and +4 tog
Man, full bellied It resembles a seated figure of a full bellied man holding a cornucopia brimming with fruits and vegetables. "A good harvest" Wait on Improves vegetation rate? "For a moment your thumb seems to turn green!"
Boy, teenage It is carved from marble in the form of a teenage human boy. "In loving memory of Nicholas, sadly yours was a life lived all too quickly." Pray Permanently increases speed (~5 points?) "You speed up."
Valkyrie It is a stunningly beautiful valkyrie warrior atop a noble horse, crafted from shimmering white marble. "Courage is a beacon of light in the darkest of places." Wait on Grants a large boost to satiation "You feel less ravenous."
Kobold Shaman It resembles a kobold shaman, but the features are more human than dog-like. It seems to be made of obsidian streaked with marble. No inscription Unknown
Creature It is crafted from some gray stone and is in the form of a huge creature you have never seen, but heard about in legends told by travelers; supposedly it roams in the far south. It has big ears, a snake-like nose, and horns protrude from its mouth. Was it your imagination or did the ground just tremble? "Gray as a mouse / Big as a house..." Kick Triggers an earthquake "The whole level suddenly is hit by a violent earthquake!"
Squidgold Squidgold, Hurthling Merchant. "Who swindled the rich and poor for profit" Kick Generates gold about 3500gp or teaches/adds points to gemology or teaches/adds points to haggling You feel price conscious. (haggling acquired?)

You suddenly lust for gems! (gemology acquired)

Orc, menacing "It depicts a menacing orc, ready for battle." No inscription Kick Generates a scroll of defense
Bird of Prey It resembles a stylized bird of prey, wings spread wide. It appears to have been carved from the darkest obsidian in a distant age. Its body rises from an enormous oval geode, split in twain. The entire statue slowly pulses with a ruddy glow. Sensing no obvious threat, you return to scanning your surroundings for danger. However, you have the strange feeling of being watched by the statue's slit like sapphire eyes. "The dark corners of the heart are

the true gateways of cHaOs..."

Cast spell Grants temporary invisibility and corrupts
Dog It looms above your head, and seems to be depicting a huge dog. Upon closer inspection, you recognize it as a wolf figure carved from dark stone. Its back is up and its teeth are bared, as it scowls its defiance towards some invisible foe above it. "Ithras. Great Wolf of Misecs Caan" Wait on A tame wolf appears. (For lawful only ?) "A tame wolf appears." Editor stepped on this statue with a Lawful High Elven Wizard female PC - no wolf appeared. There was a hostile monster in the room at the time and PC was intrinsically invisible.

Another editor received no effect with Mist Elf Duelist L+ crowned Champion of Law.

Man, red jacket It depicts a reckless, slightly crazy bearded man in a red jacket and a beautiful goddess in a pointed hat and a dark cloak with faint stars. They hold each other's hands. "Always will be." Pray Damages all undead in the room by ~10HP; removes sickness and poison; restores full HP "Your condition improves a lot."
Chaos It is a tall statue of interconnected loops, spirals, and shapes. It is hard to take it in all at once, and you need to avert your gaze after staring at it for a moment. No inscription Unknown
Warrior, Clay It is made from clay and depicts a human warrior. Strangely, as you examine the face, you see that the mouth is missing. Pray Mutes PC - permanently? "You suddenly can't speak any more."
Herb Bush It resembles an herb bush with many different blossoms. No inscription Unknown Praying - nothing

Kicking - nothing

Moving onto - nothing

Zapping wand — nothing

Casting spell — nothing

Unknown Applying Gardening skill, maybe?
Man, impish It resembles a small, impish looking man and appears to be immaculately cut from green jade. "Look behind you!" Wait on Summons a hostile Invisible stalker or Pixie "You feel watched from behind." - when summoning an invisible stalker
Guardian Maioin A giant humanoid has been sculpted from pure silver, bearing a great sword in one hand and a giant shield in the other. Its face, ornamented with emerald eyes, bears an enigmatic expression. Three pairs of translucent blue wings extend magnificently from its back, embracing it protectively with pulsating magical energy. At twenty feet tall, it towers over you. "Guardian Maion - Crafted by JZB." Wait on Grants fate smiles intrinsic. You feel protected!
Eye It resembles a large eye squinted in anger, carved roughly from a single massive piece of stone. At first glance it appears to be painted black however upon closer inspection it's clearly covered in dark sticky blood. "Mah Le Go Ah Ray" Unknown Unknown Unknown
Man, fanged It appears to be a tall, lean man, wearing a wide-brimmed hat, with circular gems that glow orange over where his eyes should be ... and fangs. "Given to the Organization in memory of incomprehensible adventurers." Wait on Creates darkness in a nine-square area around the statue Suddenly you are engulfed in darkness!
Sir Maghan It is of a handsome grifter carved from pure gypsum. "Sir Maghan, who slew the terror of the mines long before Sir Zizik ever did." Kick Generates 3 figurines of wondrous power and 3 uncursed potions of Charisma Some items are lying on the ground
Taz, the Wise It is a very large figure of a robed humanoid. It seems to have been carved out from the same stone as the walls around you, but also looks newer and much better preserved than the walls. The dungeon is too dark for you to see its upper part clearly, but it looks like it is pointing to the south-west. "Taz, the Wise" Wait on; player receives a prompt "Do you want to climb the statue? [y/N]" Chance to reach the top (for thin and nimble or very light only ?) and get potion of willpower.

Or else the statue topples and breaks, adamantium medium shield is lying on the grou nd.

You start climbing the statue. You are halfway up the statue and hanging from its outstretched arm when you realize its base is not mortared to the ground. The statue topples to the ground! Suddenly some items are lying on the ground.
Kangaroo It appears to be a kangaroo cut from a rough, red stone. "If I do this wrong, I'll kick myself." Kick Moves the player one square away from the statue "The statue kicks you back. You tumble along the floor after being hit by some strong force!" or "The statue kicks you back. You crash into an obstacle!" if wall or monster is in the way. Works even when overburdened.
Man, unpolished It is a crudely hewn figure of a man, tall and emaciated. The face is featureless and unpolished. You feel uneasy, as though you were looking upon something that isn't meant to be seen. The inscription on the plinth has been chiseled out and is unreadable. Kick A random undead appears.
Dwarf, ancient hero It appears to have been worn by the passage of time but you make out the remnants of an ancient dwarven hero. "The unholy fled before his mighty sword." Kick Generates a(n iron) long sword — which may be prefixed and/or suffixed — and 0-5 undead monsters (skeletons, zombies and mummies have been observed).

Appears that Chaotic PCs get an ashen prefix to the long sword, whereas lawful ones get the of the sun suffix. Each of these modifiers would have a considerable impact on the fight with the subsequent undead if the sword is wielded against them.

"The force of your blow knocks the sword from the statue's hand. Suddenly an item is lying on the ground." One character generated a long sword of the sun and 1-3 minor undead.

DE WS generated an ashen long sword of slaughtering and 4 lesser undead

Gnome Monk generated normal long sword, no undead.

GE Monk generated ashen long sword and 3 undead

Gnomish paladin: normal long sword, no undead.

LN Orcish Beastfighter: long sword of the sun, 1 zombie.

C ME Necromancer generated ashen longsword, a mummy, a skeleton and three zombies.

Chaos Its black stone is looped into eerie, uncanny twists and whorls. You're sure you saw it move out of the corner of your eye. "Mother of Chaos" Kick Generates at least one writhing mass of primal chaos (up to three have been observed) "You notice (x) enem(y/ies) appearing."
Humanoid, Ogre-like It comprises an imposing, ogre-like humanoid in a pose of belly-shaking mirth. The statue appears carved of red sandstone, perhaps from a far land. Within its lifelike visage, two moonstone eyes of piercing blue gaze sightlessly down and through you. "Scourge of the far north: the Reebeast." Kick Drops a sapphire "One of the gleaming eyes is knocked loose. Suddenly an item is lying on the ground."
Queen Margot You gaze in awe on a beautiful woman carved from shining white marble. "Queen Margot" Pray Restores full PP. "Energy ripples through your body." ?
Unknown It is clearly ancient. What race or gender is represented by the miserable form in front of you it is impossible to tell. The centuries have slowly taken their toll and it is a mass of cracks; it looks like a single kick would reduce it to dust. Kick Grants -1 Appearance None
Chaos The grotesque statue is made of both gold and ebony. You are not sure of its shape, it seems to bend and distort as you stare at it. "Change comes from within" Pray Removes Doomed "You feel that a sinister curse is lifted from you."
Warrior, Crude It is crudely carved from rock and looks vaguely like a warrior. It is covered in symbols of battle painted in blood. No inscription. Kick Grants +1 Strength None
Anvil It resembles an anvil, albeit a rather tiny one. "In loving memory of Conrad Konrad, the greatest weaponsmith of his time" Kick Curses all but eternium ingots in PC's backpack None
Smurf It is a small statue which represents a blue dwarf-like creature with white pants and a white hat. " "In honor of the most feared smurf of them all, MonsterSmurf!!" " Unknown
Narflung, Master of Flame It resembles a frost giant jarl, crudely hewn from a large piece of basalt. "Narflung, Master of Flame" Pray Deals ice damage; reduses healing rate slightly You feel very cold. You are engulfed by the piercing ice needles! Can kill low hp PCs, dealt (always?) 26 damage.
Woman, headless Only after a while, you spot the stony body of a petite, headless female in an entanglement of uncountable, interwoven arms holding all kinds of weaponry. No inscription Kick Unknown No message displayed (repeatable)
Spheres 16 smooth stone spheres are arranged in a complex and irrational pattern. No inscription Cast spell Statue destroying, the room is filled with local monsters. Statue crumbles to dust
Frog Prince A perfectly formed, smooth statue of a frog prince, complete with crown. It looks rather boring. No inscription Kick +1 Charisma You feel friendly.
Donkey It is a multi-colored metal figure of a donkey. It is festive looking. "Property of Senko De Mieyo" Kick Generates 3-5 bits of gnomish candy Suddenly some items are lying on the ground. Seems to refer to Cinco de Mayo [35], celebrations of which may include piñatas [36].
Warrior, ancient It is a statue of an ancient warrior, covered in ice despite the weather. No inscription Zap a wand Transforms zapped wand into Wand of Cold. Doesn't always work. The (wand) suddenly is covered with frost!
Archer It resembles an archer aiming at some distant target. He seems to be using a wand instead of an arrow. No inscription Zap a wand Drops a wand of far slaying Suddenly an item is lying on the ground.
Dragon, Ancient Karmic It appears to be an ancient karmic dragon encrusted with thousands of tiny opals. "draco dormiens nunquam titillandus" Zap a wand Summons a hostile karmic dragon or generates his corpse or generates ~5500 gold; destroys statue "A hostile karmic dragon appears." The inscription is the Hogwarts motto from Harry Potter, and translates to "Never tickle a sleeping dragon".
Arga the Artificier It resembles a strangely peacefull gnoll, proudly standing and holding out a large gem. Tiny sparks of light seems to surround it. "Arga the Artificier" Wait on Statue disappears and generates a gem. (In my test, a worthless piece of green glass) "You reach for the gem. The statue crumbles to dust! Suddenly an item is lying on the ground."
You This twisted figure smirks in delight at your odd predicament, gazing down at your petty works. looking back a second time, you imagine the statue has shifted into an unflattering mimic of you. "Your power shall be greater!" Cast spell The room receives "The air in this room seems to be magically charged." effect "You feel the mana of the world flow through you!"
Lay Priest It looks like a lay priest and feels soapy to the touch. No inscription Wait on Makes a copy of random item in your backpack (?)
Woman, naked It resembles a beautiful woman, naked from the waist up, beckoning to you with a wink. You feel drawn to it... "Love is a tricky thing." Wait on Confusion and HP restoration "You feel warmed by a wave of love... and confused" or

"You feel irritated."

No activation message or status effect was observed with Male Dwarf Weaponsmith (UD:3 v2.3.8)
Hurthling, eating It appears to be a hurthling eating from a plate full of food. "Time for second breakfast!" Wait on Satiates "You feel satiated."
Bappo Telenn, Gnome, merchant You face the statue of Bappo Telenn, a gnomish master merchant. It is adorned with the rune of Elemental Air. He is said to have been part of the adventuring party that six millenia ago defeated Chaos. At least that's your recollection from the old fairy tale.. None Kick?

Pray

Unknown

Gives the Blessed intrinsic

"You feel very bad about that."

"You feel blessed"/"You feel refused" (chaos knight, at least no blessing, maybe unknown effect)

Zzarck'alm-Choti Ib'seiw, mist elven archmage You discover a memorial statue dedicated to an ancient hero of Ancardian lore. You face the statue of Zzarck'alm-Choti Ib'seiw, a mist elven archmage. It is adorned with the rune of Elemental Water. He is said to have been part of the adventuring party that six millennia ago defeated Chaos. At least that's your recollection from an old fairy tale... None Kick

Pray

Curses?

Gives the Blessed intrinsic

"You feel very bad about that."

"You feel blessed by some higher power!"(Blessed has a longer duration than regular Bless Spell / Be blessed by this statue is repeatable)

"You feel refused" [Character's chaotic alignment caused that?]

Roumar Yardin, gray elven beastfighter You discover a memorial statue dedicated to an ancient hero of Ancardian lore.

You face the statue of Roumar Yardin, a handsome gray elven beastfighter with a pet cave bear sitting at his legs. It is adorned with the rune of Elemental Earth. He is said to have been part of the adventuring party that six millenia ago defeated Chaos. At least that's your recollection from and old fairy tale...

None Kick

Pray

Curses?

Blessed status

"You feel very bad about that!"

"You feel blessed by some higher power!"

Jinxso, hurthling necromancer You discover a memorial statue dedicated to an ancient hero of Ancardian lore.

You face the statue of Jinxso, the many-faced, a hurthling necromancer. It is adorned with the rune of Elemental Fire. He is said to have been part of the adventuring party that six millennia ago defeated Chaos. At least that's your recollection from an old fairy tale...

None Kick

Pray

Curses?

Gives the Blessed intrinsic

"You feel very bad about that."

"You feel blessed by some higher power!"

"You feel refused" [Character's chaotic alignment caused that?]