Statue is a special dungeon feature added in ADOM version 1.2.0. These statues, unlike normal statues, found in the Bug Temple or created by Petrification, are not items but are immovable objects that have chance to be generated on a generic dungeon level. Each statue features a unique description, which will be displayed as the PC moves onto its location, and (most) statues have a unique effect which can be triggered by one of the following actions:
- Kicking the statue
- Moving onto the statue's tile
- Praying while standing on the statue's tile
- Using magic (spell or wand) on the statue's tile
- ???
Each statue was submitted by one of the ADOM Resurrection campaign participants of Adventurer or higher pledge levels.
Statue mechanics
Appearance
If the PC moves on a statue's location, the message You stumble upon a statue. <statue description>. will be displayed; if the PC is literate, this will be followed by the message: An inscription at the bottom reads: "<statue inscription>".
Special messages
If a statue is located on the current level, the following message will be displayed periodically: "You sense something of historical significance."
This message appears to be working as all other fixed dungeon features' (forges, altars etc.) messages.
List of all known statues
The following list contains all discovered statues.
| Appearance | Inscription | Effect Trigger | Effect | Activation Message | Notes |
|---|---|---|---|---|---|
| It resembles a small little ugly quasit, hewn from gabbro basalt. In its hands the statue holds some sort of shovel. | "a good shovel is a key to tomb robbery" | Kick | Learn Mystic Shovel spell. | You learn the Mystic Shovel spell.
You learn the Divine Digger spell. (for divine casters) |
|
| The statue is unfinished, it's as though the sculptor ran out of time. | No inscription | Step on | Reverses (some) unnatural aging | You Feel (sic) younger | Editor noticed all four years of unnatural aging removed from a PC. Also, having age status changed from 'grown-up' to 'young' did not affect stats |
| It appears to be of a fair skinned Queen, with hair of rose gold and eyes of uncut blue-gray sapphires. | "Eleanoreus Regina Reigns" | Step on | Stuns the PC | You feel sunburned! | |
| A drakeling ranger in a readied combat stance wielding a pair of gladii. | "Vae Victis" | Kick | Temporary Buffs speed by 25/26 and strength by 9. | The Statue crumbles to dust! You quicken. (You slow down somewhat. You feel your strength waning.) | "Vae Victis" is Latin for "Woe to the vanquished" |
| It resembles a quickling. | "Trrrr digi dagi, muf muf!" | Kick | Permanently increases speed by 5. | You feel faster. | |
| It is a large cube of gray stone, with one large rune carved into each face of the cube. | "Provoke not The Four, their gifts are Destiny and Doom" | Kick | Teleports PC away (other effects also possible?) | "Suddenly you stand somewhere else." | |
| It is covered in cracks, and thick dirt but appears to be Nosaj the ancient Troll Healer. | "Be aR T E pOw r O C AoS" | Kick | Summons several Greater chaos servants around you, and drops a cursed potion of cure corruption. | "Suddenly an item is lying on the ground." | Note that Nosaj is Jason backwards |
| It resembles a young Ancardian boy accompanied by what appears to be a stuffed tiger doll, riding together in a small red cart. The statue seems to be constructed of a multitude of nondescript items. | "THERE'S TREASURE EVERYWHERE!" | Kick | Transforms all items lying diagonally-adjacent to the statue into gold pieces | "Suddenly all items transform into gold." | The statue appears to be a reference to the Calvin and Hobbes [1] comic series |
| It resembles your mother?! | "Be safe, pumpkin!" | Kick | Curses | "A voice in your head says "Is that really how you treat your mother?" " | |
| A bare-chested human with a full beard stands hunched over an empty anvil, his brow furrowed in concentration. His right hand carries a rune-carved (sic) hammer, raised as if to strike. | "Mylar Starstruck" | Step on | Trains smithing for not very skilled (<50 ?), alternatively repairs equipped melee weapon. Breaks it if not skilled at all. | "Your eternium battle axe is suddenly repaired" or "You gain new insights into the art of smithing." or "Your club breaks." or "Nothing happens." (artifact melee weapon equipped) | |
| It resembles a naked humanoid with a huge head, wearing a necklace. You try to remove the necklace, but the head is too big. | "Z" | Zap a wand | Generates an amulet. An amulet of balance, amulet of health, amulet of free action and amulet of protection have been received. The amulet generated may depend on DL? | "Suddenly an item is lying on the ground" | |
| Lights play on the gemstones, the ivory horn glitters in multitude of colors cast by the reflections. The statue resembles a black cat forged of pure obsidian, riding a rainbow unicorn! | "Nya Nya Nya Ruslan" | Step on | Grants luck; may grant fate smiles if character already has luck. | "You feel as if the light of Fate shines upon you favorably!" | This statue appears to be a reference to the Nyan Cat [2] internet meme.
The message appears to be the same regardless of what intrinsic is granted. |
| It resembles a tall human wearing a heavy coat with a peaked cap on its head bearing eagle- and skull-shaped insignia unknown to you. You can almost feel his cold stare probing deep into you. | "Max Otto von Stierlitz" | Step on | Grants temporary cold immunity; seems to make PC "sneeze exactly once!" later? | "You feel cozy!" | This statue is a reference to Seventeen Moments of Spring [3], a Soviet series |
| It resembles a young human girl of seven or eight, carved from obsidian. | "I forgive nothing." | Kick | Possibly decreases piety | No message | Possibly a reference to Nikki from Kill Bill Volume 1 [4] |
| A marble Dark Elven archer stands here. He looks very powerful and very corrupted. You sense a faint soul here. | "Neji. — Defeated all his foes except for the chaos inside of him." | Pray | Asked to help a voice from elsewhere, saying "yes" will cause three corruptions or removes all(?) corruption. At least 12 corruptions were removed. | From the other worlds, you hear a whisper asking you "Hero - I am in agony here, will you help me?" (y/n) The marble eyes open to reveal glowing balls of envy and pain. You feel a soul rushing into your body battling for control! Resisting you tear yourself away from the statue. You feel corrupted/You feel cleansed. | Level 10 human chaos knight gained 3 corruptions.
Level 7 myst elf necromancer, all 5 corruptions removed. Level 20 neutral high elven elementalist, all 3 corruptions removed. Level 45 gray elven elementalist, crowned N=, all 12 corruptions removed. |
| It depicts a standing warlock, holding a sharp, glittering sword with a hilt shaped like a miniature dragon. | "Adar, Guardian Battlemage." | Kick | Generates a murderous short sword of slaughtering | ||
| It looks like nothing you've ever seen. The form twists and shifts constantly, shimmering with dizzying energy. | "dEDiCaTeD tO tHe eSsEnCe Of ChAoS. mAy yOu AlWaYs ChAnGe!" | ||||
| It looks like a large, black stone block. It is probably made of obsidian. | No inscription | Step on | Trains random skill or granting a new one. | "You feel uplifted!" | This is a reference to the film 2001: A Space Odyssey [5] - the obsidian block is the monolith, uplifting an inferior species.
Level 1 DfDu with Le:8 got Pick Pockets at 33 (2d4) without having visited the Thieves Guild. |
| The vaguely humanoid form is completely overgrown with various plantlife and crawling with insects. | No inscription | Kick | May either generate several edible plants, or summons two insect monsters. | "Suddenly some items are lying on the ground." / "You notice some enemies appearing." |
Observed plants include a seed and apple, and a seed and 2 alrunia antidotes; summoned monsters noticed have included giant bee warriors, giant centipedes, giant ant workers and claw bugs. |
| It's of a dark-haired woman wearing a toga and holding out a golden apple | "Kallisti" | Step on | Seems to be equivalent to drinking from a Pool. | "You suddenly picture yourself biting into a tasty apple! It fills your mouth with a refreshing liquid!" | This statue appears to be a reference to the Apple of Discord [6]; the woman thus is Eris, the goddess of chaos and strife |
| It resembles a bookshelf, crafted from stone. Each book inside is crafted from a different type of rock. You don't understand the titles. | "Do you know where your towel is?" | Step on | Generates a blanket | This is a reference to the Hitchhikers Guide to the Galaxy [7] | |
| The life-sized female human monk in a fighting position is carved from a single block of ivory, her arms spread in a defensive figure. ... | "Maen, the Kata Training Master of Dela" | Kick (repeatable) | Unknown | ||
| It resembles a slightly eccentric man with long blonde flowing hair, arm held upward with a curious object in his hand. | "Gardening is the game of life!" | Kick | Causes herbs to appear in a 'Glider' shape (might be just one bush if there is not enough room near the statue) | The statue crumbles to dust! Suddenly some herbs appear! | Refers to the fact that herbs are growing by the rules of Conway's Game of Life [8] |
| It seems to look like a penguin... in a strange way. | "CP-Violation will be prosecuted by CERN." | This is likely a reference to penguin diagrams [9], a class of diagrams in quantum field theory. | |||
| It looks like an east merchant, made from gold. | "ALL YOUR MONEY ARE BELONG TO ME." | Step on (see notes) | 2% (rounded up) of the PC's gold goes disappears. | You feel slightly less encumbered. | This statue appears to be a reference to the AYBABTU [10] video game meme. The statue appears to activate only once, but it will not activate if the PC has no gold pieces. |
| It is a man with a benign smile and hair like a halo. | "Long live the Vampire Slayer!" | Pray | Restores all PP. | You feel full of power. | |
| It resembles an old magician. | "Hockaz Pockhus 187-299" | Cast spell? | Random (undead?) monster appears. | Upon casting a spell, a wraith and a ghul have been generated. | |
| It resembles an aged wizard in a dynamic pose, brandishing an ornate wand. | "In honor of the grand wandmaker ... (the rest of the inscription is worn away)" | ||||
| It resembles a dragon, but on each scale, an emblazoned rune shines. | "Callest the Thunder, and He shall Reapeth the Whirlwind." | Kick | Unknown | Note that this is grammatically incorrect; it should read either shall reap or reapeth. Also, callest is the indicative mood where imperative seems to be required | |
| It depicts two enormous dogs, pitch black and wolf-like appearance, standing guard over a fallen soldier. Their eyes seem to watch your every move... | "Here stands Pajazzo and Ulysses, never resting, ever watching." | Kick | Increases Toughness by 1 point | Note that potential doesn't increase.
Increase Pe +1 for GEWz To 10 | |
| It is of a kneeling Elven man, carved from simple granite. | "The Scions walk with you!" | Step on | Same effect as a (blessed) potion of boost willpower. | "You feel determined!" | |
| It bears a striking resemblance to Richard, the warp duck of lore. | "Qua... ...ck." | Zap a wand | Teleports PC | You teleport. | |
| It looks like an evil clown juggling human skulls. | "Gravity sucks" | Step on | Turns all monsters on level hostile, including companions | "The clown laughs at you, the laughter echoes through the dungeon." | |
| Crumbling and fallen, only the feet remain. You notice that each foot has only four toes. | "Aut viam inveniam aut faciam" | Pray | Increase Willpower by one | "You suddenly know that you will either find a way to achieve your goals or that you will make one." | The Latin phrase means "I shall either find a way or make one" and is attributed to Hannibal [11] |
| It is carved to depict a small woman, on her knees with her face drawn in a rictus of terror. | "Fear is the only weakness" | Kick | Summons random(?) undead(?) hostile monster | Possible monsters: Wraith | |
| It's a perfect sphere the size of a man's head, glowing with a faint green light. | No inscription | Unknown | Uncurses equiped items | Kicked as a lvl7 L Dwarf Priest, Unicorn Sign, got "A huge fireball explodes!", took about 25hp of damage and "The statue crumbles to dust". No detectable event other than the explosion and disappearance of the statue.
--- Kicked as lvl10 Drakish male Monk, Candle Sign, got no effect. | |
| It resembles a huge heap of old armor, rusted weapons, wands and small bottles. For a moment, you think you see something moving underneath... | "Aldrin the Always Prepared" | Kick | Drops a girdle of carrying | "An old belt falls from the statue. It seems to still be useable..." | |
| It is a sandstone figure of a small dog. Its ears taper to points, and carved muscles bulge underneath its skin. | "To the unknown jackal." | Pray | Causes a tame jackal to appear. | Suddenly a jackal appears. | |
| It looks like a mad wizard ripping pages out of a spellbook. | "Knowledge is a finite resource: the more you learn, the more you forget" | Kick | PC un-learns a skill at random, then the PC learns a new random skill (at skill level 1d100). | ||
| It appears to be a large crowned bearded man surrounded by carved squirrel companions. | "You shall nut pass!" | Kick | Randomly spawns additional (hostile?) monsters on the level.
Crashes the game in pre23, fixed in current versions. |
"A booming voice bellows: "Ye have incurred wrath of the Squirrel King!"
The stone squirrel companions spring to life and surround you!" |
Pun on Tolkien's Gandalf [12] |
| It is of an Avatar of Balance, a wide cloak billowing around him. The avatar's left arm is hidden by the cloak, but his right arm extends outward and holds a sword as tall as the avatar, the tip just touching the ground. Hanging from the cross-guard is an ornate pair of scales, perfectly balanced on fine chains. | "To the ancient judges; in whose dominion Balance reigned supreme." | Pray | Unknown; prayer is also heard by PC's deity | "Your prayers are heard." | Editor was playing as a neutral PC |
| It seems quite brittle and eroded. You can't decipher what it once may have resembled. | No inscription | Step on | PC becomes blinded by dust eroding from the statue. The effect is similar to the glob of mud rooms, since it can only be cured by using the wipe face command. | When activated: "You are blinded by the dust eroding from the statue." When remedied: "You clean your face from all the dust." |
|
| It is carved from a single, solid piece of granite. It seems to represent a once great lord of some considerable girth wrapped in grand robes. He is resting upon a throne before which stands a pedestal holding a great tome with archaic runes. | "You gain some, you lose some. You can't have it all." | Unknown | Activation methods attempted: kick, pray, read spellbook, read scroll, zap wand, cast spell - no step-on message | ||
| It resembles a humanoid standing square and emotionless. It appears to be missing a chunk of stone on his head. | "75% Off" | Kick | Statue breaks and summons Doop, a tame stone golem. | "The statue hums and vibrates for a moment, and then appears to come to life. It slowly turns toward you and mutters: "Zoop bing bada doop." " | |
| It resembles a tall, winged figure clad in a breastplate and gripping a broadsword. You feel faint waves of blessed power emanating from the sword. | "Mieaevar" | Step on | Restores some HP and PP. (For lawful only ?) | "You feel righteous... and right!" | |
| It seems to be a male figure with the head of a hippopotamus, made of granite. | "GueuetiteueuG" | Step on (repeatable) | Confuses the PC if not already confused, removes confusion if already confused | ||
| It depicts an old man wearing sideburns. The man is holding a scroll with a 17-pointed star inscribed on it. | No inscription | Cast spell | Temporary +20 Le | This is likely a reference to Carl Friedrich Gauss [13], a German mathematician. | |
| It looks like a very great computer from the beginning of the 1980ties, it is brown and very similar to a bread bin. | "Commodore C64, Made In W. Germany" | Pray | Restores HP; prayer is also heard by deity | "You feel healed. Your prayer remains unheard." | |
| It is a wooden statue of a giant rat. | "Squeek!" | Kick | Summons hostile giant rat(s) | ||
| A mighty hero stares down at you from the golden pedestal. You are awed by the strong and yet graceful curves. This is truly a godly figure. Oh wait... you recognize yourself! | "Self-esteem is golden, but valor is beyond price" | Kick | Destroys the statue, reduces HP to 1 and generates 100 gold in the statue's place; deafen the PC for 100 turns; clears cursed and doomed intrinsics; grants +1 Willpower and +1 Appearance | "The statue crumbles to dust! Suddenly you hear a thousand bells ringing in your head. You fall onto the ground writhing in pain. And yet you feel good about what you just did. Suddenly an item is lying on the ground." | |
| It represents a monster of vaguely anthropoid outline, but with an octopus-like head whose face is a mass of feelers, a scaly, rubbery-looking body, prodigious claws on hind and fore feet, and long, narrow wings behind. | "Ia! Q'thulu ftaghn!" | Step on | Grants Lucky intrinsic to chaotic PC, temporarily confuses others | Reference to Cthulhu of the Lovecraft mythos [14] | |
| It's a sphere. | "That's no moon." | Step on | Generates a stack of cursed penetrating drakish scurgari of targeting | "Suddenly an item is lying on the ground" | Possibly a reference to Obi-Wan's line from A New Hope [15] |
| On closer inspection it looks like a barrel-chested man. His eyes are flickering and shimmering in thousands of colours. He is smiling at you with seemingly endless joy, careless joy, knowing that his lucky day could be the day of your doom. | "Does fate smile upon you?" | Step on | Decreases luck (like karmic creatures). Or increases it (depending on Mana (40+) ?) | "You feel less lucky"/"You feel more lucky" | A PC once lost the Fate Smiles intrinsic by it, while another PC with no positive luck-based intrinsics received the cursed intrinsic from it |
| It is made of some unnatural watery substance which streams without losing its form. The statue seems to be vaguely familiar to you. ... | "Who are you?" | Kick | Increases Willpower by 2 and Charisma by 5; corrupts; destroys statue | "You hesitate, and then suddenly kick the statue with full force. The statue shatters. You are annoyed by your own weaknesses, but immediately feel proud and confident again for overcoming them." | At least three PCs have been observed to transform into a chaos being after gaining 18/19 corruptions at once (if PC is Chaotic or Neutral?). Other PCs have been observed to pick up one corruption that was not announced by the game after kicking the statue. |
| It is a warrior carved in white stone, sword in hand, another sword strapped to his back. You notice a finely crafted wolf's head talisman hanging on his neck. | "To G. of R., a true hero and friend of dwarvenkind." | Step on | Generates a necklace of the eye | Suddenly an item is laying on the ground. | This is a reference to Geralt of Rivia, the main protagonist of the Witcher [16] series. |
| It resembles a human, whose appearance seems to be strangely familiar. | "Sometimes, you gotta run before you can walk" | Step on | Increases Speed by 5 | "You speed up." | |
| It resembles an ancient black dragon, hewn from pure black diamond. | "nive idvi ciiv" | Pray | With ~50% chance generates a sword of sharpness | Suddenly an item is laying on the ground / You have a feeling of loss | The inscription is an anagram of the phrase "veni vidi vici" [17] |
| It is covered with permafrost and is too cold to touch. | "I long for eternal frost and black winters." | ||||
| Upon it stands a man, tall with close cropped hair. He wears strange bulky armor only covering the torso, with a rounded helmet. In his hands is a gently curved sword, held in a ready, yet relaxed position. He carries a pack that looks extremely heavy. | "Dijheans, he fought in a war that did not remember him or his comrades." | Step on | +10 Capacity | "You notice your burden lightens slightly." | |
| It depicts the face of a man of about forty-five, with a heavy black moustache and ruggedly handsome features. | "Ignorance is strength." | Kick | +1 Willpower | "You suddenly know that you will either find a way to achieve your goals or that you will make one." | Appears to be a reference to George Orwell's novel 1984 [18]. Crashes the game in pre23 (win7 64bit) |
| Delicately carved from granite and smoothly polished, a young, lithe woman lies prostrate on an ornate settee. She is clothed in thin, revealing attire, with one hand resting wearily against her forehead, and the other reaching languidly outwards. Her posture suggests great personal despair. | "...and 'lo that wench, upon this bench, her fate was sealed in stone." | Step on | Deafens the PC. | "Your ears are assaulted by a high-pitched screeching... then you hear nothing at all." or "Your ears tingle." (if already deaf) | |
| It resembles 10 shining monkeys, hewn from pure Diamond. | "SSAGAZY!" | Step on | Same effect as a blessed scroll of identify | "You feel enlightened!" | |
| It resembles a strong farmer with a dog by his side wielding an ancient trident. | "Hard work and a strong back can overcome any obstacle." | Kick | Generates a trident and two potions of strength | Suddenly some items are lying on the ground | |
| It appears to be a stone tree, covered with specks of dried blood. | "Ouch!" | Kick | Causes heavy bleeding | ||
| It resembles a fearful knight. Pure darkness radiates from its obsidian eyeballs. | "Only the penitent man shall pass." | Pray | Corrupts (~1 effect) | May be a reference to Indiana Jones and the Last Crusade[19]Praying here while being chaos knight did removed 5 corruptions including the starting ones. | |
| It is shaped as the most gorgeous woman you ever saw, with stunning eyes and shimmering hair. You feel a surge to deliver her. | No inscription | Pray | Summons a doppelganger; prayer seems to also be heard by PC's deity | "As <PC's deity> relieves the prisoner from its petrified state, she suddenly transforms into a very known person. Your prayers remain unheard." | Male or female characters |
| It shows a leaping fish. | No inscription | Kick | Unknown | No message | |
| It appears to be a dwarf, brandishing a battleaxe with one hand, and with the other drinking deeply from a frothing tankard. | "Bundin the Besotted - His virtue was solid, and his courage, liquid." | ||||
| The statue is cast in bronze and resembles a Barbarian accompanied by a snarling dog. | "Pray that your dog never bites you!" | ||||
| It resembles a goblin berserker, hewn from a 100 carat brilliant blue sapphire | "Chaos will prevail" | Kick | Grants intrinsic invisibility to the PC | ||
| It looks like a giant frog made of pure emerald. | "Berep!" | Step on | Grants Lucky intrinsic | "You suddenly hear a croaked "Berep". You feel the urge to smile!" | |
| It is made from shiny round rocks, vaguely resembling a hurtling (sic) figure. | No inscription | Kick | Drops a pile of rocks | "Suddenly an item is lying on the ground. The statue crumbles to dust!" | Dropped 5 (+2, 1d4) rocks
Dropped 6 (+0, 1d4) rocks in another instance - seems like the rocks are random |
| It appears to be a standing disc filled with a mix of blue and purple stained glasses in a complicated kaleidoscopic pattern on both sides. It is supported by a grey stone carving that resembles a large cloud. | "Winds of Omen" | ||||
| It is a tall statue of a short figure; a hurthling with a determined grin and a full pack. Graffiti scratched into the stone reads "Better a small fire that warms than a great fire that burns" | "The Lost Volcano Expedition" | Step on | Grants resistance to fire, stunning and confusion | "You feel ready for the heat!" | Once of the statues in the Bug Temple is dedicated to a hurthling, called Wor Janoth, who was the "Explorer of the Lost Volcano". |
| It resembles the head of a horse. It expression is an ambiguous mix of panic and frenzied elation. | "Prepare for Final Fulfillment" | Kick | Permanently increases speed 5 points OR drops a wand (possibilities include door creation, digging, acid, fire, lightning at least) OR does nothing. | "You feel faster." OR "Suddenly an item is lying on the ground." OR no message. | |
| It is shaped like a perfect hemisphere, made from some unknown metal. Though its surface is tarnished, you can still see your distorted reflection. | No inscription | Kick | Generates a fireball centered on the statue. | "A huge fireball explodes! You are engulfed by the roaring flames! The statue crumbles to dust!" (ADOM release 52). "The statue crumbles to dust! You feel a strong shock wave." (ADOM 1.2.0 Prerelease 23?) | Generates an "Illegal ball damage type(3)." error in ADOM 1.2.0 Prerelease 23. |
| It is covered in moss and has lost some of its original definition to the ages it was sculpted. It resembles a man, with the legs of a beast. He holds something in his hands, a musical instrument or tablet bearing writing in some forgotten script? | "The Great God Pan" | Direct reference to the god Pan [20] in Greek mythology. | |||
| It resembles an old wizard, hewn from fine, white marble. | "DO NOT DISTURB!" | Kick | Stuns for a few turns, teleports PC and drops alignment. | No message | N- high elven druid got to C after kicking the statue. |
| It depicts an ancient dragon slumped, dead on the floor. A goblin stands atop it, victorious. | "For the cursed will be blessed and the earth shall be theirs." | Kick | Wand of digging appears on the floor; also generates wand of earthquakes for cursed PC and wand of destruction for doomed PC | Suddenly an item is lying on the ground. | |
| The statue looks surprisingly much like you, only smaller. | "Ye who wants to know it all should know thyself first." | Kick | Same effect as potion of insight / Revelation spell; or else same effect as potion of confusion. | "You suddenly feel very self-knowledgeable." or "You are confused." | Seems to depend on learning (literate/Le:18 works, illiterate/Le:8 doesn't, illiterate/Le:15 also works) |
| Unknown and partly hidden in the shadows, the statue portrays a tall and vigorous human of unclear age. ... | "Societas Eruditorum" | Could be a reference to "Societas eruditorum incognitorum in terris Austriacis"(The Society of Anonymous Scholars in the Austrian Lands). [21] | |||
| A layer of ice covers it completely and an aura of cold seems to be emanating from within. Just below the surface you can make out a human face screaming in agony. | "Where are the frost giants I've begged for protection?" | Step on | Decreases speed by 5 | "The air in your lungs seems to be cooling to an almost unbearable level. Ice crystals are starting to form on your skin and you gear. Perhaps you should leave before you freeze into a statue yourself." | May refer to the song Too Late: Frozen by Typo O Negative [22] |
| Of Great Sisters | "AN GI NA" | Kick | Increases Charisma by 1 and statue disintigrates. | "You feel friendly" | It is a reference to The Great Giana Sisters [23] game. "AN GI NA" is an anagram of "Gianna" (misspelled heroine's name) |
| Delicately carved from dark green granite, this huge brute of a man stands leering over you. ... | "Rene, Son of Rel. Master of Blades, Bringer of Storms." | Kick | Unknown | No message | |
| It is a stunning sculpture of a swarm of blue scarabs, accented with gold and precious gems. | No inscription | Step on | Increases Dexterity by 1. | "You feel very nimble" | |
| On the weathered stone you discern the features of a tall elf, his right arm holding a lute, his left distorted in a mass of tentacles, a sly grin on his scarred face. | "All hail Tarindil, master of music, embracer of ChAoS!" | Step on | Charisma+1, Learning+1.
Corruption or corruption removal. See notes. |
"A dark and enchanting tune hangs in the air for a moment, and you feel your mind wander to forbidden places." | Effect is likely bugged in r49: PC with no corruption got 1 corruption level. PC with about 0.5-1 corruptions got some corruption points removed. PCs with 5 and 17 corruptions were cured from all corruptions (but left with some corruption points). |
| You find a gargoyle entombed in unadulterated terror. The statue smells of the sea. The statue has a marble ring of the fish in one of its hands. | "If found, ship to the Gorgades Islands." | Pray | No effect | No message | Gorgons [24] from Greek mythology were thought to live on the Gorgades Islands (which may refer to modern Cape Verde [25]). |
| It portrays a man bound to the earth with heavy chains. | "A name is an omen." | Kick | Earthquake | "The whole level is suddenly hit by a violent earthquake!" | |
| It is a statue of a man with lifted arms, standing
on top of a large gate-like arch of unhewn white stones. |
"Off we go!" | Step on | Several (2 and 4 observed) swordsmen appear next to the PC. | ||
| It represents a young elven woman holding a fairy dragon in her hands, exquisitely crafted from mithril. | "In Memory of Thecla" | Step on | Summons a tame fairy dragon | "A tamed fairy dragon appears." | |
| The statue seems to want to talk to you, its half-grinned face seems to follow you around the room... eventually the statue begins to explain various countries' corporate and civil laws. You are bored enough to fall asleep! | "this is a lawful statue" | Kick | You feel corrupted! Enough to receive one corruption. | ||
| It pictures a long man in a robe whose gaze is at the distance and who is holding a thick book in his hand. The man has the symbols of the elements engraved in the back of his robe. | "Jussi Viinikainen, pioneer in elemental research" | Step on | Player is prompted to read a set of runes on the foot of the statue (y/n); various effects are available depending on PC's Learning score (temporary confusion, receiving intrinsic random elemental resistance, resistance to all elements, or failing to read the runes to no effect at all) | When gaining resistance to all elements: "You understand the runes. You now fully comprehend the principles of the elements." | |
| It resembles a beautiful dragon, carved from the purest crystal. The statue glistens in the light like a myriad fires. | "Humble yourself before the lord of the mountain lake!" | Pray | Grants +2 Learning | No message | Reference to Guy Gavriel Kay's Fionavar Tapestry series. |
| It is a great hulk of black obsidian, depicting an ancient warrior. His armor is dented and battered, his sword broken, and his shield split. He is covered in scars from numerous battles. ... | "Though ye be doomed, if ye have breath, fight on." | Pray | If not already doomed: dooms the PC and summons an air grue, a water grue, and fire grue and a stone grue around him/her. The statue also gets destroyed.
If doomed: grants paralysis resistance intrinsic and destroys statue. |
If doomed: "The statue crumbles to dust! You feel incredible surge of strength pass through you." | |
| It resembles a bard with a long-necked lute with four thick strings. | "Bow your head to lowland vibe" | Pray | Generates lute {Lakland} (was uncursed/doomed and L+ crowned) | The 'lute' described is more than likely a bass guitar [26] | |
| It resembles a grinning man with a pamphlet under his arm, counting on his fingers. It is made from pyrite. You suspect he cheated. | "When speed must needs exceed" | Kick | Unknown | None | |
| It's a hollow square cube that you can see into from the top. The statue is half filled with middy [sic?], lumpy water. | "Waste not, want not." | Kick | |||
| It resembles a bipedal frog with one foot much larger than the other in a martial arts pose. | "In memory of Ribby - the foot of justice and beloved king." | Kick | You'll slide one step from statute. No health damage. | The statue rotates on its base and kicks you back! You tumble along the floor after being hit by some strong force! | |
| It resembles a foot. | "Artist unknown" | Kick (repeatable) | None other than a message? | "A booming voice shouts: "Ow!" " | |
| You don't notice anything unusual. Or do you? | "Please return to the finder." | Step on (repeatable) | Unknown | You feel happy and content. | |
| It resembles a decrepit old hag, dressed in tattered rags. | No inscription | Stepping on the statue. | May make the PC Sick. | You feel decrepit. | (Specifics not known - done to a Dark Elf Ranger, further testing needed.) GnWiz do not suffered |
| A caryatid stands here, holding the ceiling above you. | "Do not kick." | Kick | Earthquake on whole level. | The whole level shakes violently. | Seems to produce much more destruction that just one casting of Earthquake spell. |
| It appears to be a cenotaph for an adventurer who lost her way in the dark. | "Tipi Marjukka Ainas, YASD" | Kick | Generates a wand, scroll, or amulet of light | The statue crumbles to dust! Suddenly an item is lying on the ground | YASD — a commonly used acronym in the ADOM community — means "Yet Another Stupid Death" |
| It is a very lifelike stone warrior standing a shield raised on defense and a sword readied to strike. | "Sir Archenon the gremlin slayer. Arch Gremlin tricked him to petrify himself." | Kick | Generates a long sword with a prefix or suffix. | Prefixes observed: fickle, white, wicked.
Suffixes observed: mayhem, defense, penetration, fumbling. | |
| It appears to have been crudely hewn out of some sort of indistinguishable material. It doesn't seem to resemble anything in particular. The only thing that is definite about this statue is the unmistakable feeling of dread it inspires in you. There appears to be an inscription at the bottom. Are those... claw marks? | (There appears to be no actual inscription. The above is part of the description.) | Step on | Breaks, releasing a chaos monster, that depends on PP. chaos rat (PP < 40);
chaos plague bearer (PP > 40); chaos spawn (PP > 80); chaos knight (PP > 160); writhing mass of primal chaos (PP > 320); balor (PP > 640). Also drains all PP. |
||
| The statue seems to depict a troll, unlike any you have seen. Tall and lean, it almost looks like a giant elf. Covered in heavy armor from head to toe, gigantic sword in one hand and massive shield in the other. You imagine he must have been the very symbol of invulnerability in life. | "R.I.P. Jalmag, the troll warrior, grand master smith, felled by the Lich King." | Step on | Chance to fix rusty or broken equipped item | "You hear a voice in your head: "YE'LL NIID HELP! 'ERE! BASH DEM GUD!" | Kicking, stepping on, nor praying with high elven archer seems to doing nothing. Stepping on with dark elven beastfighter resulted in voice. |
| It is an obsidian statue of a wine bottle, faintly glowing from within. | "Em ebibmi! (it's "imbibe me" backwards)" | Kick | Generates potion of gain attributes or potion of cure corruption; destroys the statue | "The statue crumbles to dust! Suddenly an item is lying on the ground." | |
| Acheatarus, Demigod of the Unspoiled | "It is better to have loved and lost than to never have loved" | Step on | Summons a tame monster | ||
| It has no head. Its outstretched arms still bear the weathered symbols of some long-forgotten noble's hall. | "No more can any man achieve than this." | Kick | Destroys the statue | "The statue crumbles to dust!" | |
| It is the skillful carved cat from a dark wood. Black eyes of the statue seem to glow a bit of light. | No inscription | Kick | Drops two worthless pieces of white glass | "The eyes of the statue drop to the floor. Suddenly some items are lying on the ground." | |
| It is too worn to be sure, but it resembles some ancient swordsman, standing at attention. | No inscription | Kick | Generates a mithril long sword | "The statue crumbles to dust! Suddenly an item is lying on the ground." | |
| Soirana, troll bard while in the midst of deadly singing accompanied with bone breaking clubbing. | "Eto po lubvi" | Pray | Generates a gem | "Suddenly an item is lying on the ground." | Inscription refers to a song by Russian band Mumiy Troll [27] |
| Shod of silver, it resembles a proud and haughty looking human, who bears the symbols of a mindcrafter. | "Only those who can keep their thoughts focused in one place dare approach." | Step on | Unknown | You hear a voice in your head: "Welcome student, I have much to teach you...". The statue crumbles to dust!
"Don't waste my time!" |
Has one of two possible effects; if the player doesn't meet a certain requirement (Orcish beastfighter got it w/o any intrinsics except poison) they are (randomly) teleported; if they do meet it learning is trained (?) (The human barbarian I encountered the statue with experienced an increase to learning just a hundred or two turns later.) Possibly Le dependant (Orc beastfighter was eligible at Le:7) |
| It appears to be a small iron figurine of a cowled gnome. Unremarkable in appearance yet seems to be posed in a way to suggest he is hiding something from view. | ""I'm the jinx, so what?"" | Kick | curses | ||
| A jumble of stone and metal loops intertwine into a wondrous figure. While seeming chaotic, the eye is quickly drawn to follow the curves, building a pattern as you continue to gaze at it. A tear leaks from the corner of your eye. No art has ever moved you this way, you cannot move for fear of losing this moment. | "Understanding eternity takes time." | Step on | Briefly paralyzes, restores PP | "You are flooded with power!" | |
| It's a rather creepy statue. A female form in alabaster, dressed in a all-encompassing habit, praying. The palms are pointed towards her though, trying to cover her eyes. Her eyes are carved ivory and in each corner is a tiny sapphire - as if she were weeping. | "Don't blink. Blink and you're dead. Don't turn around and don't blink." | Refers to the Weeping Angels [28] from the TV Show Doctor Who. The inscription is a quote from the Doctor regarding these entities. | |||
| A solitary siren sits atop a pile of bones. | No inscription | 1.2.0pre23, crashed the game when steping on it. Caused a Crash in 1.2.0. Seems fixed in Release 60. | |||
| It is a beautiful emerald statue of a miniscule, grinning magical figure with glistening amethysts for eyes. It seems to brim with magical energies. | "A rare, elusive 'leprechaun', that hails from a beautiful realm far far away" | Kick | Grants teleportitis to the PC | None | |
| Colored a deep blue, its shape seems to change while you look upon it. | "Take Each Random Little Opportunity, Boldly." | Kick | if boots are on - bless them, else damages slightly | "Your feet feel relaxed" / "Your feet hurt." | |
| It resembles a winged unicorn made of pure white marble. | "Blessings I give to all my faithful students." | Pray | Blesses all spellbooks in backpack | Reference to the character Princess Celestia in My Little Pony: Friendship is Magic. | |
| A cat-sized dragon with an impish grin and carved of near-translucent crystal lies at ankle level. | "To Glitterwing, true companion, fearless hunter, and reckless troublemaker." | Kick | Fairy dragon appears | Status (hostile/non-hostile/tamed) of apearing monster depends on charisma score. Apparently with 9 charisma it apears non-hostile but becomes hostile when action taken. | |
| It's a winged unicorn with stars in its mane. | "Huzzah!" | Pray | Grants the see invisible intrinsic | "You are blessed by the goddess of the night!" | My little pony reference to princess Luna, from the episode, "Luna eclipsed". [29] |
| It depicts a small, tubby man, carved from a dark wood. He is smiling widely and carries a small cask under his right arm. | "I share freely" | Kick | A murky liquid spills from the cask making you drunk | ||
| It has the shape of a large-bodied man; with short arms and stubby legs. A round head is topped with a thin streak of hair like the fin of a fish. | "VISCERA" | Kick | Dooms | "Oops." | Likely a reference to Nelson Frazier, Jr |
| It oddly resembles the shape of a boot. | "For every action, there is an equal and opposite reaction" | Kick | Knocked back one square | The statue kicks you back. You tumble along the floor after being hit by some strong force! | Reference to Newton's 3rd Law [30] |
| This appears to be a statue of a ratling warrior of exquisite craftsmanship - you can make out the tiniest wrinkles on the creature's skin, the tiniest dents on its scales and armor. The figure is standing on one knee, cowering under a shield and stretching an arm as if attempting to strike an imaginary foe. There is a mixture of horror, desperation and anger on the ratling's face. | "Do not touch." | Pray | Curses, destroys the statue | "*FOOLISH MORTAL! I'M NOT HERE TO BRING BACK TO LIFE YOUR PETRIFIED RATLING FRIENDS* The statue crumbles to dust!" | Effect occurs whether you are a ratling or not. |
| You are shocked to discover it's a statue of you. The lifeless stone eyes seem to meet your stare. The effect is quite disturbing. | "Erected in memory of a brave adventurer, Rest In Peace." | Step on | Dooms PC | You feel as if your final days are upon you! | |
| it resembles a winged lion with the head of a human woman. it seems to be carved from solid granite and has a sculpted book before it. | "Knowledge is another form of power" | Pray | +1 Learning | You feel knowledgable [sic]. | |
| It is a mere meter tall, and depicts a vaguely humanoid creature with large eyes, tentacles and eyestalks. | "Alien's corner of quiet and guilt." | Step on | Mutes the PC.
[temporary - same as harpy corpse?] |
||
| It appears to be of a large jackal carved out of jet black obsidian with sparkling rubies for eyes. | "I guard the veil against any who would violate it." | ||||
| It depicts a weasel with two heads. Each eye is made from different kind of gemstone. | "Ancient Weasel of Eldritch Knowledge." | Pray | +2 Learning, -1 Charisma | "You absorb eldritch knowledge and are altered by it!" | |
| It resembles a middle-aged man wearing a wizard's robe. Curiously, he is holding a shield in each hand. The shield wielded in his right hand is silver with a circular motive. His other shield is almost perfectly black. You can feel experience and power radiating from the statue. | "Drauf Momo Olepisk, a sorceror from a land quite nearby." | Pray | ? | No message | |
| It depicts an elf with a look of horror frozen on her face. | "Not all petrification goes bone-deep." | Kick | Summons a hostile writhing mass of primal chaos. | ||
| It resembles an ancient white rabbit, hewn from gold smelling faintly of frankincense. | "Cas Go Par!" | Kick | Unknown | "<PC's deity> mumbles Myrrh..." | The references to gold, frankincense and myrrh could be a reference to the gifts of the three Kings / Wise Men at the nativity of Jesus |
| Small and shaped like an elegant cat, stretching, it is made of crumbly white alabaster with pink ruby eyes that seem to sparkle as if lit by a ray of sunlight. | "Willow, a gentle creature, she loved the light and we loved her" | (Doesn't respond to kicking, prayer or stepping on. Zapping a wand of light or casting light doesn't work either. Maybe a crystal of light would do something?) | |||
| Carved from a block of silver leaf jasper, it depicts a lightly built, short-haired cat with friendly slanting eyes and dark points. | "Requiesce cat in pace Darion" | Step on | Removes curse | ||
| It appears to be of a robed figure, holding a tome. | "Argyll, the compiler of odd tales" | Reading | Generates a book(?) | Character was bard with 21 Le and 100 literacy. Generated book was teleportation.
Another character: trollish barbarian with 24 Le and 85 literacy. Cursed book of magic missile was generated. | |
| A band of cocky trolls, petrified by their encounter with reality, still appearing to smugly surveying.. their surroundings with upturned noses and blind eyes. | "In memorandum of things best forgotten" | Step on | Decreases stats; changes of -1 Str, -1 Le and -1 Wi were observed | "Your morale drops" | Seems to be a reference to internet trolls [31] |
| The mottled black and red eudialyte stone has been polished and sculpted into the shape of a giant, humanoid heart. | "I want to hear your screams!" | Step on | Decreases alignment (N- to CN, NL to CN and N= (crowned) to N- observed); alters stats: +1 Le, +3 Wi, +4 Dx, -1 To, -2 Ch, -3 Ap, +2 Pe | "Your eyes blacken momentarily as the statues darkness infuses you. You feel changed." | |
| An ashy blackness pulses over the statue's surface, giving it an appearance of gaseous immateriality. | "There's no smoke without fire!" | ||||
| The dark statue of a tall, athletic man lies ahead of you. A mischievous smile is frozen on his face, and bright green eyes seem to be fixing you with their gaze. | "I do what I try what I am" | Step on | -5 St, -5 To, drops the amulet of petrification resistance | "As you get close to the statue you feel weak, and your vision blurs slightly. As you slump to the ground, tired and dizzy, you see the color of the statue going from dark to fair, coming to life in front of your eyes. The man whispers his thanks in an insidious voice, and disappears." | |
| Apart from the two rubies it has for eyes, it is made of pure black onyx, absorbing any light that touches it. Its eyes remind you of someone from ancient times, someone whose face you remember seeing in old tomes... a scholar or wizard, perhaps? | "Teach and be taught!" | ||||
| It is of a thinly built man huddled as if to squeeze through a narrow gap. He leads with a stone crossbow, held at arm's length. | No inscription | ||||
| It appears to be a fierce dwarf ranger cunningly depicted out of a massive block of granite. | "ye'll need more than that to hurt me!" | Kick | Does ~88 points of damage without killing the PC (reducing it to minimum 1 HP) and increases Toughness by 1 | 1 PC was reduced to 1 HP, another from 202/202 to 114/202. Both didn't die, and got 1 To. | |
| It seems to be a wooden carving of a kobold holding a baby human | "To Mkita, for not eating my baby" | ||||
| It depicts a heavily armored dwarf playing dice against a gnome, who's just lost his armor on the game. | "The luck is the greatest armor of all." | Pray | Unknown | None | |
| A kobold carved of pure alabaster takes a defensive stance, tightly clutching a spear. Despite being wounded, the small creature's face remains brave and determined. | "Small But Fierce" | Kick | Injures the PC; no other noted effects
[v1.2 removes part of current Health, adds to max PowerPoints. Not know if its permanent of temporary effect] |
"You feel weak and overpowered." | A reference to the Kobold Quarterly[32] magazine, now out of print. |
| A giant cat is poised as if to pounce, carved from white marble with inlaid stripes of tiger's eye across its back and tail. Its eyes are blue sapphires and glow faintly! | "Sharaleo" | Pray | Grants see invisible intrinsic | "Your eyes tingle." | |
| This is the statue of a tall human magician, clothed in a long tunic. A decided expression is on his face, and a beautifully-sculpted flame raises from his extended hand. | "Ubun, the fire elementalist. Igne nature renovatur integra." | Pray | Triggers a fireball/explosion on the statue's square | "A huge fireball explodes!" | |
| It is covered with dense foliage but you see a gleam of sapphire underneath. | "Twig the Lurker!" | Kick | Gem is put where you were standing (Sapphire or random?) | "The foliage rustles. Suddenly an item is lying on the ground." | |
| It's a dwarf raising his ale mug up high! | "Beware the consequences!" | Step on | Confuses for couple turns | "Your head hurts!" | |
| It resembles a young boy with chestnut brown hair cropped in a bowl cut. | "Yllib LLa Reve!" | Kick | Generates a wild cat | ||
| It depicts a slight human with unruly hair and skewed glasses that seems to be staring intently at some arcane chalky scribbles on a nearby wall. | "The rule of thumb!" | Step on | PC gains marks for all weapon skills (including missile weapons and shields) | "You gain some surprising insights into your combat abilities." | |
| An exquisitely detailed marble sculpture. It is a perfect likeness of you! | "No adventurer will ever match this peerless original." | Step on | Summons a hostile doppelganger | "Suddenly a copy of yourself appears." | |
| It resembles a very old and ugly-looking man. His eyes seem to glow a tiny bit and figure itself feels like alive when caught by a peripheral vision. The long dead body of an adventurer is nearby. | "Koschei (might be obfuscated to hide the relation to the Koschei the Immortal)" | ||||
| It seems to resemble some variety of terrifying quadrupedal beast. Intricately crafted from granite, razor-sharp hooked claws and needle-like teeth catch your eye. | "Beware! A great and perilous beast hast been entrapped within." | Kick | Summons a hostile wild cat | "A hostile wild cat appears." | |
| It looks like a man wearing immaculate clothes. You feel as if he disapproves of your beggar look. It seems to look right into your soul. You feel as if it knows all your deepest secrets and desires. Better than you do. | "You rang, Milord?" (Milady if female) | Unknown | Activation methods attempted: kick, pray, read spellbook, read scroll, zap wand, cast spell - no step-on message | ||
| It resembles a happy gnome that enjoys the flow of the nature forgetting the violent ways of the wilderness. | "Respect the things greater than the races of Ancardia." | ||||
| It resembles a small brown bear, crafted from rough hewn wood. | "Clifton, the bear" | Pray | If doomed summons ~6 hostile grizzly bears, else summons a tame brown bear | ||
| It depicts a young barefoot amazon clad in wolf pelts about to ready an arrow onto her longbow. Her long locks of hair and delicate features are so gracious and lifelike you are immediately struck by her beauty. | No inscription | Kick | Puts PC in sleep for about 20 turns and the statue disappears. Restores full HP and PP. | Suddenly the statue shudders and appears to shake itself back to life!
The long locks of hair turn jet black and flow about as she shakes her head fighting the drowsiness of an age old sleep. Her head then turns from side to side looking for prey. As she spots you she quickly readies an arrow! For a second you feel a strange sense of fascination as her eyes look deep into your eyes. Before you can react the magical arrow hits you in the chest! Waves of magic pour over you. You feel drowsy. You smile before helplessly falling into a deep sleep. |
|
| It is very smooth and completely dark, when you touch it you feel a small carved impression of a boot. | "Feel the power in your feet" | Kick | Grants the see invisible intrinsic | "Your eyes tingle" | |
| It seems to be a male minotaur dressed in leather and female orc in plate mail holding hands. | "Mutabull, Minotaur Druid, and Hafwenharu, Orc Paladin" | Pray | Removes unnatural age; the prayer will also be heard by the PC's god in this case | "You are reminded of a love from your youth." | |
| It portrays a tall man, his face alight with wonderment, his eyes lost in the contemplation of knowledge that transcends the mundane world of commoners. .. | "Phi Ricardus Nnam, human archmage, melder of lights and ambers, 918--988" | Step on | Increases Learning (at least 1-4 points) | "You feel enlightened!" | |
| It seems very thankful. | "Welcome back" | Step on | Generates a mithril weapon of the most skilled type | "Welcome back to our lands. You are instrumental to our future. We could not have done it without you." The statue crumbles to dust! Suddenly an item is lying on the ground. | Effect was observed with a level 16 gnomish barbarian who was fighting with his heir gift (brutal two-handed sword), and a mithril two-handed sword (+6, 3d5+6) [-1,+0] was generated in this case. A level 11 hurthling barbarian wielding an adamantium scimitar received a cursed balanced mithril broadsword (+7, 1d7+5). A lvl13 DE Wizard wielding Skullcrusher received uncursed mithril dagger (+0, 1d4+5). A beastfighter (most skilled in unarmed combat) received a piece of mithril ore. Level 8 orcish barbarian wielding adamantium short sword got (+1, 1d8+4) mithril spear because polearm weapons training was at level 5, and swords only at level 2. |
| It's a strange humanoid creature with fourteen outstretched arms. They almost look as wings of a skeletal angel. # of the hands are clenched into fists. [# equals to the number of scrolls the statue was given previously.] | "Scroll of literacy check recall center." | ||||
| It is the crumbling remains of a humanoid warrior mounted on a small horse. It has been carved from brittle sandstone. | "... ... Friendship ... ... ... ... | Step on | Statue breaks, temporarily boosts Charisma by a small amount | "You feel friendly." | |
| Cheerful maiden in a dynamic pose of a dancer, cast from pure gold, her back straight, arms held tight to her body. As you adjust your sight, you notice that light flickering ghastly on statue's fair features makes an illusion of rapid legs' movement. | "Queen Thea Maris, The Butterfly Dancing with the Morning Star" | Pray | Speed boost | "You quicken!" | (similar to the potion of the boost speed) |
| It is in the shape of a huge, golden horseshoe. | "Luckyshoe" | Step on | Adds Lucky intrinsic | "You feel lucky." | |
| A foppish-looking human is carved into the marble. His grin is somehow infuriating. | "LATE TO BED AND EARLY TO RISE GIVES A HERO SAGGY EYES" | Kick | Generates several (3-4 observed) scrolls of amnesia | ||
| Of a wizard who looks as if he was about to cast a spell. | "Call upon me when it seems magic may be the only remaining answer." | ||||
| It represents an old trollish figure wearing shamanic clothes. | "No'Grok, healer of the Keg'Sham tribe, but also a fervent follower of Vagrak." | Pray | "You feel both healed and corrupted. You feel corrupted." | Corrupts PC | PC was a level 4 grey elven wizard. Apparently also causes damage, since he died immediately afterwards. Cause of death was "broke his leg while kicking at the air." Level 8 trollish barbarian was corrupted by activating, but didn`t get corruption. |
| It resembles two entangled snakes in the act of swallowing each other tail, shaped like a lemniscate. | "The only way life can stay alive is to devour other life. Nothing is sacred." | Nothing happened when illiterate male barbarian troll, clvl 5 steped on nor when kicked the statue. Need further investigation. | |||
| It resembles a gnome carved from a clear blue stone. | "In honor of Twidgie - emissary to the trolls and cryomancer of legend." | Kick | Get some castings of Frost Bolt. | "You feel cold." | |
| A statue of an immensely corrupted drakeling appears to be staring at something. | "You cannot outrun your destiny." | Step on | Temporarily boosts speed | ||
| It is a crystal phoenix, filled with magma and
glowing a violent red. |
"HS, AR/SLDR, TBAB, C" | ||||
| Crafted from marble it depicts a human in strange garb - one hand bearing a flame and the other an orb. | "Sven T Sexgore: Mad Genius & Part-Time Deity" | Pray | Grants fire resistance intrinsic | ||
| This crudely-chiseled statue seems to have been carved by the very dwarf it was meant to depict... after he had a few too many dwarven ales. Either he had serious genetic problems or he wasn't a very good sculptor. | "Orris, dwarven monk" | Kick | Confuses, makes drunk, reduses healing rate slightly | "You suddenly feel more powerful and quite dizzy. Also, your foot hurts. You can think clearly again." | |
| It has a look of a raven on the pedestal of pure black onyx. An old tome is lying under the claws. | "Those who follow the path of Elendar may be enlightened." | Pray | Dooms, PC is randomly teleported away from statue | "You are suddenly lost. Suddenly you stand somewhere else. You hear raven's caw from a distance. You feel very bad about it." | |
| Made from a single slab of black ivory, it represents a large rodent. A marmot, or perhaps a groundhog. Hard to say, since it's been subject to extensive weathering. The animal seems to be wearing some sort of spectacles, and holds in its paw a device that resembles a sundial. | "So the eve of tomorrow is the eve of today..." | More than likely a reference to the rabbit from Alice in Wonderland | |||
| It resembles a huge egg, hewn from polished granite. | "Only a fool would try to break me." | Kick | Damages the PC by half of current HP; grants -1 Strength | One-time message: "The statue does not budge." | |
| It depicts a dark-hooded creature. You cannot discern its race or class. Beneath the flaps of the cloak you catch a glimpse of something shiny, metallic. | No inscription | Kick | Teaches Backstabbing to the PC. If it is topped, teaches Stealth. Dooms lawful PC. | "You feel more skillful." | neutral GnMo was cursed |
| A gleaming obsidian statue depicts a crowd of horsemen on top of a hill, with a crowd of goblins cowering around them. | "Never forget the Conquest." | Pray | No visible effect | The sound of hooves trampling the ground rushes into your mind... and fades out with the sound of goblins gnashing her teeth. | |
| It looks like a goat. | No inscription | Stepping on statue | Increases strength (?);
Blesses character |
"You feel supported." | |
| It resembles a hurthling archer, apparently eating some sort of cake. | "Omno mune zur!" | Pray | Increases satiation (~ 1500) | "You feel slightly more satiated." | |
| A magnificent obsidian statue of a large cat sitting on top of a chest, one paw extended. | "Ilmaleipuri, the hungry one" | Pray | Grants fate smiles intrinsic; the prayer will also be heard by the PC's deity | "The statue seems to smile at you for a second. You smile back." | |
| It resembles a beautiful person with long hairs, statue is made from light pure marble without any marks of aging. It makes you wonder about the legendary princess of Ancardia. | "Those who meet my fallen knight will know the strength of the toughest love." | ||||
| it resembles a fawn, somehow always staring at you, almost as if its turning its head when you look away. Initially the statue appears to be made of wood but upon closer inspection you realize it is marble, masterfully carved to look so. | "From dust we are created and to dust we shall return." | Step on | -1 St; possibly dooms; other effects, possibly item destruction? | You feel weaker. Some dust drizzles from your backpack! You feel very bad. A voice booms: "FROM DUST WE ARE CREATED AND TO DUST WE SHALL RETURN" | The effect may sometimes be just a strength loss, without the other effects or message text past "You feel weaker."; the actual effects triggered may depend on certain factors that are not yet known.
Sometimes there are no effects whatsoever, and there are no messages generated as well. |
| The statue depicts an old drakeling carrying a tome in one hand and a polearm in the other. | "Herald of Lore" | Cast spell | Destroys statue and summons a giant rat in its place, which carries a spellbook of whatever spell was cast. | ||
| It is an ice sculpture of a leopard with sapphire eyes. The ice glows from within, there is something trapped inside. | "Snow falls gently as silence reigns in a moonlit glade and pines bend to winter" | Kick | Generates two rings of ice | ||
| It depicts small figures, possibly dwarves or gnomes, boarding a strange-looking ship inside a large cave. The statue is made from rough stone. It seems to be unfinished | No inscription | Pray | Unknown | ||
| A peculiarly formless statue. or |
"THE UNKNOWN GOD" | Pray | No effect | No message | |
| Wrought in hardwoods, its intricate detail evokes a druid with lightning bursting from the fingertips. | "At last, we meet again..." | (K)ick the statue | A hostile druid appears | ||
| It looks like a combination of dragon, human, and octopus with tentacles hanging from its head. It reminds you of some ancient god, sleeping at the bottom of the ocean... | "Kneel before me when the stars are right and I shall
conquer the worlds!" |
Pray | Hostile least daemon appears | Reference of Cthulhu, a fictional deity created by writer H. P. Lovecraft and first introduced in the short story "The Call of Cthulhu", published in the pulp magazine Weird Tales in 1928. | |
| It is a tiny statue of a raven, which you might have missed amidst the rubble had you not been looking closely. | "The secret to vast riches is to save every penny" | Step on | Generates one gold piece | ||
| A statue that defies description, beyond simply a column of power, rising hundreds of feet into the air. | "Adventurer beware" | Step on | Reduces HP to 1 and restores PP to full | "You feel full of power and very weak at the same time." | |
| It seems to flicker in and out of existence. The few glimpses you manage to catch of it seem to radiate in all the colors of the rainbow. | "Seeing is believing" | Step on (repeatable) | Grants the see invisible intrinsic | ||
| A stone reproduction of a water fountain stands before you. | "Behold water immemorial, adventurer: not frozen but held in time." | Step on | Paralyzes the PC for about 15 turns | "Suddenly you feel as if were frozen in time!" | |
| It is a crude humanoid figure, clutching a sword in one hand and a strange, angular goblet in the other. | "An Adventurer is You!" | Pray | Generates a potion of booze | This is the logo and tagline of browser-based RPG Kingdom of Loathing [33], in which booze is an important item. | |
| Brushing away the dust of ages you reveal the terrifying visage of an Ancient Chaos Wyrm. A shudder passes through your body as a whisper enters your mind "fear me mortal, for I am your doom". | Kick | Corruption | |||
| It resembles an infinitely complex crystalline structure which glows with a strange light. | "gatataatccataccattatcat" | The inscription is a gene sequence. | |||
| It resembles a vaguely elven female figure, formed from dark granite. A strange, wavering symbol is etched into the figure's chest. | "i' alkar en' Lol'th" | Step on | Summons a dark elven priestess. | Priestess was companion for Troll Chaos Knight and chaotic Dark elf Necromancer. | |
| Carved out of black rock, it appears to be a vile zombie with fearsome plated armor seemingly bolted and nailed into the its.. decaying flesh. Curiously, the statue seems to radiate heat. | "Zombos, Lord of the Undead" | Kick | Triggers a fireball / explosion at the statue's location. | Zombos also appears as a boss monster | |
| It resembles a gnomish hero. | "Fus Roh Dah" | Pray | Fire resistance | "You cool down." | |
| It resembles a wiry, spotted feral cat, made from sandstone and black granite. Its emerald eyes seem to stare at you! | Step on | Temporarily boosts speed | "You quicken!" | ||
| It appears to be of a tall human of ambiguous gender, its long fangs the only clues that it is in fact a vampire. There is what looks like long dried blood on the fangs and looking into its eyes you feel a strange desire to add some of your own to the stains. | "feed me and I shall help you to feed from others." | Step on | Permanently reduces max HP by 20; a murderous adamantium broadsword of vampirism is generated on the square | "You feel some icy force feeding on you!" | |
| It depicts a large man with a goatee and a stern expression. Wherever you move his eyes seem to follow. His clothing is very ordinary save for a fuzzy hat which seems out of character. In his hands is a very sophisticated and powerful crossbow with the name "Vera" etched in the stock. The statue appears to be made of incredibly strong ceramic. | "Jayne Cobb" | Pray | Generates gold pieces, 5258, 6602, 7357, 8322, 9000 and 9904 observed. | Jayne Cobb is a character in the show Firefly. One of his weapons is named "Vera". | |
| It appears to be a ferocious-looking Orc, carved from jade. It wields a greataxe with a bloodthirsty grin. | "The Warlord's Fury" | Pray | If non-chaotic and non-orc: summons 2-4 hostile orcs Otherwise: summons a tame orc |
"Suddenly some orcs appear." or "A tame orc appears." | |
| It is of a rather ugly human in an unusual pose. Its face, which is turned to look behind it, is twisted in fear. A large, lumpy sack is clutched in its right hand. | "Such is the fate of those who would steal from Solia the Wizard." | Cast spell | Generates items | "Absorbing some of the magic from your spell, the statue comes to life. "Mercy!" The thief hurriedly empties his bag and scurries away.
Suddenly some items are lying on the ground." |
|
| Oddly enough, this marble statue seems to resemble you. | "Fragile" | Kick | Reduces Appearance by 1, damages as if you kick yourself | "The kick breaks off a piece of the statue's nose and a jagged crack runs across the statue's face. A few seconds later your own head rocks back from an invisible blow that breaks your nose." | |
| It is made of aged and splintering wood, the details too faded to make out. It appears to be holding a wand. | "Mage's Folly" | Cast spell?
(Light was cast once) |
Confuses, possibly other effects too. | "You feel as if you have blundered" | |
| It depicts a spear wielding nomad, its hair painted blue. | "Saito Wanderer Doomwarder" | Cast spell | Blinds the PC? | "You think you smell sweet ferns." | |
| It is an ancient, cracked statue of an emaciated man, bent with age. | "I will show you fear in a handful of dust." | Kick | Ages the PC by 10 years | "You feel older." | 10 years has been observed for a ratling and a dark elf. |
| It's of a winged humanoid with upraised hands, made of polished marble. | "Reach the sky." | Step on | Speed+3.
Also temporarily boosts speed hugely [200 extra points were recorded] |
"You feel as if the sky has become somewhat closer!" | |
| An elf and an orc kissing, hewn from granite. | "John and Stephanie forever" | Step on | +1 Mana | "You feel more powerful." | |
| It appears to be a squatting dragon in hewn slate with its tail coiled around the base of the statue. | "Claws of dragons - humans' blood streaming - unseen sparkling..." | Pray | Mutes (permanently?) | "You suddenly can't speak any more." | |
| It depicts a <PC's race> <PC's class>. | "<PC's name>" | Kick | Deals damage to the PC | "You hurt yourself." | |
| It's a rough barbarian in thick furs. He's clutching a mirror with both hands. | "The way home" | Kick | Unknown | None | |
| It resembles some type of oil lamp. | No inscription | Kick | Grants a wish, or summons a hostile djinni. | "You have been granted a wish." or "A hostile djinni appears." | Sadly can only be kicked once. |
| It appears to be a medium sized man in a bowler hat, vest, and bow tie. | "Nobody No-one was here." | A reference to Doctor Who audio stories? [34] | |||
| It resembles a large si. | No inscription | Pray | Increases random attribute by 10 permanently | "You feel trained." | |
| It is shaped like an angel with her wings spread, sculpted in white marble. | "Rest, ye righteous." | Step on | One off full healing for non-chaotics. | "You feel great." | |
| It appears to be a sculpture of a hungry-looking wizard. | "Here lies Hoagie the Cave Wizard, entombed by hunger for all eternity." | Step on | Either hugely boosts the PC's satiation, or increases it straight to Bloated (variable amount) | "You feel bloated!" | |
| It resembles the trout jumping out of the river. | "Thanks for all the fish" | Pray | ? | "The statue laughs at you" | A reference to the Douglas Adams books [35] |
| Two great legs of stone and a fallen, frowning head are all that remains of the once proud sculpture. | "Look on my works, ye mighty, and despair!" | Kick | Temporarily blinds the PC (~6 turns) | "You hear a distant scream of rage, echoing across the centuries. Suddenly a hot gust of desert wind blows sand past you, stinging your eyes. You are blinded!" | Reference to the poem "Ozymandias" by Shelley. |
| It depicts a life-size ratling in gray stone. All of its facial features appear to have been chiseled off and sanded over. | "Know me not, and I will not know you." | Pray | dooms the PC if Dexterity < ~50, else advances stealth, grants +2 Dexterity and temporary invisibility | "For a moment, you feel something looking at you... and eyes you with contempt as it notices you / but its gaze seems to pass over you." | The statue always depicts a ratling, regardless of the PC's race. |
| It appears to be of a grizzled Gnollish Warrior. | "Dogbreath, a mighty warrior of the hidden fortress at Deegi'eff" | Kick | +1 St, -1 Le, +1 To, -1 Ma | "You feel different." | |
| It resembles a seated figure of a full bellied man holding a cornucopia brimming with fruits and vegetables. | "A good harvest" | Step on | Improves vegetation rate? | "For a moment your thumb seems to turn green!" | |
| It is carved from marble in the form of a teenage human boy. | "In loving memory of Nicholas, sadly yours was a life lived all too quickly." | Pray | Permanently increases speed (~5 points?) | "You speed up." | |
| It is a stunningly beautiful valkyrie warrior atop a noble horse, crafted from shimmering white marble. | "Courage is a beacon of light in the darkest of places." | Step on | Grants a large boost to satiation | "You feel less ravenous." | |
| It resembles a kobold shaman, but the features are more human than dog-like. It seems to be made of obsidian streaked with marble. | No inscription | Unknown | |||
| It is crafted from some gray stone and is in the form of a huge creature you have never seen, but heard about in legends told by travelers; supposedly it roams in the far south. It has big ears, a snake-like nose, and horns protrude from its mouth. Was it your imagination or did the ground just tremble? | "Gray as a mouse / Big as a house..." | Kick | Triggers an earthquake | "The whole level suddenly is hit by a violent earthquake!" | |
| Squidgold, Hurthling Merchant. | "Who swindled the rich and poor for profit" | Kick | Generates gold about 3500gp or teaches/adds points to gemology or teaches/adds points to haggling | You feel price conscious. (haggling acquired?)
You suddenly lust for gems! (gemology acquired) |
|
| "It depicts a menacing orc, ready for battle." | No inscription | Kick | Generates a scroll of defense | ||
| It resembles a stylized bird of prey, wings spread wide. It appears to have been carved from the darkest obsidian in a distant age. Its body rises from an enormous oval geode, split in twain. The entire statue slowly pulses with a ruddy glow. Sensing no obvious threat, you return to scanning your surroundings for danger. However, you have the strange feeling of being watched by the statue's slit like sapphire eyes. | "The dark corners of the heart are
the true gateways of cHaOs..." |
Cast spell | Grants temporary invisibility and corrupts | ||
| It looms above your head, and seems to be depicting a huge dog. Upon closer inspection, you recognize it as a wolf figure carved from dark stone. Its back is up and its teeth are bared, as it scowls its defiance towards some invisible foe above it. | "Ithras. Great Wolf of Misecs Caan" | Step on | A tame wolf appears. (For lawful only ?) | "A tame wolf appears." | Editor stepped on this statue with a Lawful High Elven Wizard female PC - no wolf appeared. There was a hostile monster in the room at the time and PC was intrinsically invisible.
Another editor received no effect with Mist Elf Duelist L+ crowned Champion of Law. |
| It depicts a reckless, slightly crazy bearded man in a red jacket and a beautiful goddess in a pointed hat and a dark cloak with faint stars. They hold each other's hands. | "Always will be." | Pray | Damages all undead in the room by ~10HP; removes sickness and poison; restores full HP | "Your condition improves a lot." | |
| It is a tall statue of interconnected loops, spirals, and shapes. It is hard to take it in all at once, and you need to avert your gaze after staring at it for a moment. | No inscription | Unknown | |||
| It is made from clay and depicts a human warrior. Strangely, as you examine the face, you see that the mouth is missing. | Pray | Mutes PC - permanently? | "You suddenly can't speak any more." | ||
| It resembles an herb bush with many different blossoms. | No inscription | Unknown | Praying - nothing
Kicking - nothing Moving onto - nothing |
Unknown | |
| It resembles a small, impish looking man and appears to be immaculately cut from green jade. | "Look behind you!" | Step on | Summons a hostile Invisible stalker or Pixie | "You feel watched from behind." - when summoning an invisible stalker | |
| A giant humanoid has been sculpted from pure silver, bearing a great sword in one hand and a giant shield in the other. Its face, ornamented with emerald eyes, bears an enigmatic expression. Three pairs of translucent blue wings extend magnificently from its back, embracing it protectively with pulsating magical energy. At twenty feet tall, it towers over you. | "Guardian Maion - Crafted by JZB." | Step on | Grants fate smiles intrinsic. | You feel protected! | |
| It resembles a large eye squinted in anger, carved roughly from a single massive piece of stone. At first glance it appears to be painted black however upon closer inspection it's clearly covered in dark sticky blood. | "Mah Le Go Ah Ray" | Unknown | Unknown | Unknown | |
| It appears to be a tall, lean man, wearing a wide-brimmed hat, with circular gems that glow orange over where his eyes should be ... and fangs. | "Given to the Organization in memory of incomprehensible adventurers." | Step on | Creates darkness in a nine-square area around the statue | Suddenly you are engulfed in darkness! | |
| It is of a handsome grifter carved from pure gypsum. | "Sir Maghan, who slew the terror of the mines long before Sir Zizik ever did." | Kick | Generates 3 figurines of wondrous power and 3 uncursed potions of Charisma | Some items are lying on the ground | |
| It is a very large figure of a robed humanoid. It seems to have been carved out from the same stone as the walls around you, but also looks newer and much better preserved than the walls. The dungeon is too dark for you to see its upper part clearly, but it looks like it is pointing to the south-west. | "Taz, the Wise" | Step on; player receives a prompt "Do you want to climb the statue? [y/N]" | Chance to reach the top (for thin and nimble or very light only ?) and get potion of willpower.
Or else the statue topples and breaks, adamantium medium shield is lying on the ground. |
You start climbing the statue. You are halfway up the statue and hanging from its outstretched arm when you realize its base is not mortared to the ground. The statue topples to the ground! Suddenly some items are lying on the ground. | |
| It appears to be a kangaroo cut from a rough, red stone. | "If I do this wrong, I'll kick myself." | Kick | Moves the player one square away from the statue | "The statue kicks you back. You tumble along the floor after being hit by some strong force!" or "The statue kicks you back. You crash into an obstacle!" if wall or monster is in the way. | Works even when overburdened. |
| It is a crudely hewn figure of a man, tall and emaciated. The face is featureless and unpolished. You feel uneasy, as though you were looking upon something that isn't meant to be seen. | The inscription on the plinth has been chiseled out and is unreadable. | Kick | A random undead appears. | ||
| It appears to have been worn by the passage of time but you make out the remnants of an ancient dwarven hero. | "The unholy fled before his mighty sword." | Kick | Generates a(n iron) long sword — which may be prefixed or suffixed — and 0-4 undead monsters (skeletons, zombies and mummies have been observed). | "The force of your blow knocks the sword from the statue's hand. Suddenly an item is lying on the ground." | One character generated a long sword of the sun and 1-3 minor undead.
DE WS generated an ashen long sword of slaughtering and 4 lesser undead Gnome Monk generated normal long sword, no undead. GE Monk generated C ashen long sword and 3 undead Gnomish paladin: normal long sword, no undead. LN Orcish Beastfighter: long sword of the sun, 1 zombie. |
| Its black stone is looped into eerie, uncanny twists and whorls. You're sure you saw it move out of the corner of your eye. | "Mother of Chaos" | Kick | Generates at least one writhing mass of primal chaos (up to three have been observed) | "You notice (x) enem(y/ies) appearing." | |
| It comprises an imposing, ogre-like humanoid in a pose of belly-shaking mirth. The statue appears carved of red sandstone, perhaps from a far land. Within its lifelike visage, two moonstone eyes of piercing blue gaze sightlessly down and through you. | "Scourge of the far north: the Reebeast." | Kick | Drops a sapphire | "One of the gleaming eyes is knocked loose. Suddenly an item is lying on the ground." | |
| You gaze in awe on a beautiful woman carved from shining white marble. | "Queen Margot" | Pray | Restores full PP. | "Energy ripples through your body." | ? |
| It is clearly ancient. What race or gender is represented by the miserable form in front of you it is impossible to tell. The centuries have slowly taken their toll and it is a mass of cracks; it looks like a single kick would reduce it to dust. | Kick | Grants -1 Appearance | None | ||
| The grotesque statue is made of both gold and ebony. You are not sure of its shape, it seems to bend and distort as you stare at it. | "Change comes from within" | Pray | Removes Doomed | "You feel that a sinister curse is lifted from you." | |
| It is crudely carved from rock and looks vaguely like a warrior. It is covered in symbols of battle painted in blood. | No inscription. | Kick | Grants +1 Strength | None | |
| It resembles an anvil, albeit a rather tiny one. | "In loving memory of Conrad Konrad, the greatest weaponsmith of his time" | Kick | Curses all but eternium ingots in PC's backpack | None | |
| It is a small statue which represents a blue dwarf-like creature with white pants and a white hat. | " "In honor of the most feared smurf of them all, MonsterSmurf!!" " | Unknown | |||
| It resembles a frost giant jarl, crudely hewn from a large piece of basalt. | "Narflung, Master of Flame" | Pray | Deals ice damage; reduses healing rate slightly | You feel very cold. You are engulfed by the piercing ice needles! | Can kill low hp PCs, dealt (always?) 26 damage. |
| Only after a while, you spot the stony body of a petite, headless female in an entanglement of uncountable, interwoven arms holding all kinds of weaponry. | No inscription | Kick | Unknown | No message displayed (repeatable) | |
| 16 smooth stone spheres are arranged in a complex and irrational pattern. | No inscription | Cast spell | Statue destroying, the room is filled with local monsters. | Statue crumbles to dust | |
| A perfectly formed, smooth statue of a frog prince, complete with crown. It looks rather boring. | No inscription | Kick | +1 Charisma | You feel friendly. | |
| It is a multi-colored metal figure of a donkey. It is festive looking. | "Property of Senko De Mieyo" | Kick | Generates 3-5 bits of gnomish candy | Suddenly some items are lying on the ground. | Seems to refer to Cinco de Mayo [36], celebrations of which may include piñatas [37]. |
| It is a statue of an ancient warrior, covered in ice despite the weather. | No inscription | Zap a wand | Transforms zapped wand into Wand of Cold. Doesn't always work. | The (wand) suddenly is covered with frost! | |
| It resembles an archer aiming at some distant target. He seems to be using a wand instead of an arrow. | No inscription | Zap a wand | Drops a wand of far slaying | Suddenly an item is lying on the ground. | |
| It appears to be an ancient karmic dragon encrusted with thousands of tiny opals. | "draco dormiens nunquam titillandus" | Zap a wand | Summons a hostile karmic dragon or generates his corpse or generates ~5500 gold; destroys statue | "A hostile karmic dragon appears." | The inscription is the Hogwarts motto from Harry Potter, and translates to "Never tickle a sleeping dragon". |
| It resembles a strangely peacefull gnoll, proudly standing and holding out a large gem. Tiny sparks of light seems to surround it. | "Arga the Artificier" | Step on | Statue disappears and generates a gem. (In my test, a worthless piece of green glass) | "You reach for the gem. The statue crumbles to dust! Suddenly an item is lying on the ground." | |
| This twisted figure smirks in delight at your odd predicament, gazing down at your petty works. looking back a second time, you imagine the statue has shifted into an unflattering mimic of you. | "Your power shall be greater!" | Cast spell | The room receives "The air in this room seems to be magically charged." effect | "You feel the mana of the world flow through you!" | |
| It looks like a lay priest and feels soapy to the touch. | No inscription | Step on | Makes a copy of random item in your backpack (?) | ||
| It resembles a beautiful woman, naked from the waist up, beckoning to you with a wink. You feel drawn to it... | "Love is a tricky thing." | Step on | Confusion and HP restoration | "You feel warmed by a wave of love... and confused" or "You feel irritated." |
|
| It appears to be a hurthling eating from a plate full of food. | "Time for second breakfast!" | Step on | Satiates | "You feel satiated." |